Skip to main content

Advertisement

Table 2 Primers used in the overlap PCR to introduce a nucleotide mutation to the rescued virus

From: Construction and sequencing of an infectious clone of the goose embryo-adapted Muscovy duck parvovirus vaccine strain FZ91-30

Primer name Primer sequencea Amplification size
PM-1 5′ TCTCCCCATGGTTACTCTGG 3′ 839 bp
PM-2 5′ GTCCGTAGAGCCATATAGCAT 3′
PM-3 5′ ATGCTATATGGCTCTACGGAC 3′ 657 bp
PM-4 5′ TCTCAGGAGATCTCTCTCCGGACT 3′
  1. aThe restriction enzyme site (NcoI and BglII) in the primers was denoted with italics and the mutated nucleotide set in primers was underlined