Skip to main content

Table 2 Sequence of HPV16 and HPV18 E6 primers and ACTB primers used for real-time PCR

From: Absence of high-risk HPV 16 and 18 in Chinese patients with oral squamous cell carcinoma and oral potentially malignant disorders

Name Sequence
HPV16 E6-F GTCATATACCTCACGTCGCAG
HPV16 E6-R AGCGACCCAGAAAGTTACCAC
HPV18 E6-F GTTTCTCTGCGTCGTTGGAG
HPV18 E6-R GGTGCCAGAAACCGTTGAAT
ACTB-F TCCCTCTCAGGCATGGAGTC
ACTB-R AATGCCAGGGTACATGGTGG