Skip to main content

Advertisement

Table 1 Primer sequences for quantitative real-time polymerase chain reaction

From: Newcastle disease virus infection in chicken embryonic fibroblasts but not duck embryonic fibroblasts is associated with elevated host innate immune response

RNA target Forward primer (5' → 3') Reverse primer (5' → 3') Product size (bp) GenBank accession no.
Chicken
 GAPDH CCTCTCTGGCAAAGTCCAAG CATCTGCCCATTTGATGTTG 200 NM_204305
 TLR3 ACAATGGCAGATTGTAGTCACCT GCACAATCCTGGTTTCAGTTTAG 123 NM_001011691
 TLR7 TGTGATGTGGAAGCCTTTGA ATTATCTTTGGGCCCCAGTC 218 DQ780342
 IL-1β GCTCTACATGTCGTGTGTGATGAG TGTCGATGTCCCGCATGA 80 NM204524
 IL-6 CCTGTTCGCCTTTCAGACCT GGGATGACCACTTCATCGGG 171 EU170468
 IL-8 ATTCAAGATGTGAAGCTGAC AGGATCTGCAATTAACATGAGG 196 DQ393272
 LITAF CCGCCCAGTTCAGATGAGTT GCAACAACCAGCTATGCACC 130 AY765397
 IFN-a ATGCCACCTTCTCTCACGAC AGGCGCTGTAATCGTTGTCT 387 EU367971
 IFN-r TGAGCCAGATTGTTTCGATG CTTGGCCAGGTCCATGATA 248 DQ906156
 MHC-I AAGAAGGGGAAGGGCTACAA AAGCAGTGCAGGCAAAGAAT 222 NM001031338
 MHC-II CTCGAGGTCATGATCAGCAA TGTAAACGTCTCCCCTTTGG 312 DQ008588
Duck
 GAPDH ATGTTCGTGATGGGTGTGAA CTGTCTTCGTGTGTGGCTGT 176 AY436595
 TLR3 GAGTTTCACACAGGATGTTTAC GTGAGATTTGTTCCTTGCAG 200 NM_001310782
 TLR7 CCTTTCCCAGAGAGCATTCA TCAAGAAATATCAAGATAATCACATCA 154 AY940195
 IL-1β TCGACATCAACCAGAAGTGC GAGCTTGTAGCCCTTGATGC 185 DQ393268
 IL-6 TTCGACGAGGAGAAATGCTT CCTTATCGTCGTTGCCAGAT 150 AB191038
 IL-8 AAGTTCATCCACCCTAAATC GCATCAGAATTGAGCTGAGC 174 AB236334
 LITAF ACAGGACAGCCTATGCCAAC CATCTGAACTGGGCGGTCAT 96 EU375296
 IFN-a TCCTCCAACACCTCTTCGAC GGGCTGTAGGTGTGGTTCTG 232 EF053034
 IFN-r GCTGATGGCAATCCTGTTTT GGATTTTCAAGCCAGTCAGC 247 AJ012254
 MHC-I GAAGGAAGAGACTTCATTGCCTTGG CTCTCCTCTCCAGTACGTCCTTCC 196 AB115246
 MHC-II CCACCTTTACCAGCTTCGAG CCGTTCTTCATCCAGGTGAT 229 AY905539
 Chicken and Duck IFN-β CCTCAACCAGATCCAGCATT GGATGAGGCTGTGAGAGGAG 259 AY831397