Skip to main content

Table 1 Oligonucleotides used in this study

From: Analysis of the interaction between host factor Sam68 and viral elements during foot-and-mouth disease virus infections

Primer Name Sequence
P-Q180AForward Sam68 GGGGAAGATTCTTGGACCAGCCGGGAATACAATCAAAAGAC
P-Q180A-Reverse Sam68 GTCTTTTGATTGTATTCCCGGCTGGTCCAAGAATCTTCCCC
P-Q391A-Forward Sam68 GAAGGCTATTACAGCCAGAGTGCCGGGGACTCAGAATATTATGAC
P-Q391A-Reverse Sam68 GTCATAATATTCTGAGTCCCCGGCACTCTGGCTGTAATAGCCTTC
P1579 S IRES -T7 GGATAATACGACTCACTATAGGTTTTCATGAGAAATGGGACGTCTG
P1580 AS IRES CCTTCCTGTGGCTCGTGGTAGG
P1329 S A24-T7cre GGATAATACGACTCACTATAGGGCTTGAGGAGGACTTG
P1330 AS A24-cre GTCAGTTGGGGAAACCTGCTT
P-21036-IRES loop 1- T7 GATAATACGACTCACTATAGGTTTTCATGAGAAATGGG
P-21037-IRES loop 1 Rev CTGCTTAGATCGTG
P-1584-IRES loop 2 For-T7 GATAATACGACTCACTATAGGCAAACCGTGCAATTTG
P-1585-IRES loop 2 Rev GTACAAAGTGTCACCCCTCTAGACCTGG
P-21034-IRES loop 3 For -T7 GGATAATACGACTCACTATAGGGTGTTTGACTCCACGTTCG
P-21035-IRES loop 3 Rev GCCTGTCACCAGTGCTTGAGTACCAG
P-1581-IRES-4 For -T7 GGATAATACGACTCACTATAGGGACAGGCTAAGGATGCCCTT
P-1582-IRES-4 Rev ATTCAGACATAGAAGCTTTTTAAACCGGGCG
WT domain 4 probe 5′Biotin-AAGGGGACCGGGGCUUCUAUAAAAGCGCCCGGUUUAAAAAGCUUCUAUGUCUGAAUAGGUGACCG-3′
Mut domain 4 probe 5′Biotin-AAGGGGACCGGGGCUUCUAUACGAGCGCCCGGUUUACGAAGCUUCUAUGUCUGAAUAGGUGACCG-3′
P-2182-Infusion-FMDV A24 ires For GCTTTCCAGGTCTAGAGGGGTGACACTTTGTACTG
P-2183-Infusion-FMDVa24 ires Rev GGTTGTTGGGTCTAGAATAGAACACTTTTCTCTCACC