Skip to main content

Advertisement

Table 1 RPA primers and probes designed in this study

From: Development of a fluorescent probe-based recombinase polymerase amplification assay for rapid detection of Orf virus

Name Sequence (5’ –3’) Genome location(U33419.1)
ORFVRPA F1 CTAGTAAGCTGTTCGAGATCACCTTGTTCATCATG 4465-4499
ORFV RPA F2 TTCCGACGGACGTATGAATATGTCCATGGTGAACG 4530-4564
ORFV RPA F3 CGTATGAATATGTCCATGGTGAACGATGTACCAAC 4540-4574
ORFV RPA R1 AGCGTTCATTCAATTCATGTCTGAGGTAAACGGCA 4702-4736
ORFV RPA R2 GACCACGTAAAAGTGGTGTTCGAAAAACTTCACAA 4651-4685
ORFV RPA R3 GGTAAACGGCAATGATGTTCGTGACAAAGACCACG 4679-4713
ORFV RPA P AACGTATCCCATGCAGTAAAGCATAGTCCG 4582-4631
  (FAM-dT)C(THF)C(BHQ1-dT)TATAAACTCAGGAAC-p  
  1. ORFV RPA F and R, RPA primer; ORFV RPA P, RPA Exo probe; BHQ1-dT, thymidine nucleotide carrying Black Hole Quencher 1; THF, tetrahydrofuran spacer; FAM-dT, thymidine nucleotide carrying fluorescein; P (phosphate), block elongation