Skip to main content

Advertisement

Table 1 Primer information

From: Reverse-transcription, loop-mediated isothermal amplification assay for the sensitive and rapid detection of H10 subtype avian influenza viruses

Name Primer sequences (5′-3′) Genome position
FIP = F1c + F2 CATTGTGTGAGAAGGTGATATTA F1c, 794-772
-ACAATTTTGTTCCGGTTGTTG F2, 681-701
BIP = B1c + B2 GATAGCACCGAGYCGAGTTAG B1c, 802-822
-ACAATTATTGTCTATTGGTGCAT B2, 880-858
F3 TGGGACACAATCAYTGTCCA 634-653
B3 TATAGAACCCCCTCTCCAAA 913-894
LF GAAAATCAATCCGCCCACTT 746-727
LB ATTGGAAGAGGATTGGGGAT 830-849
  1. Genome position according to the HA gene of A/duck/Guangdong/E1/2012(H10N8) (GenBank accession no JQ924786.1)