Skip to main content

Table 3 Primers used in the study

From: Efficient generation of influenza virus with a mouse RNA polymerase I-driven all-in-one plasmid

Target/template Primer Sequence (5′ → 3′)a
MTI-EGFP/pYA4392 P1 ttgtcgcccggagtactggtcg
P2 attggacctggagataggtagtagaaacaaggtag
MPI/mouse genomic DNA P3 ctaccttgtttctactacctatctccaggtccaat
P4 tacgtctgaggccgagggaaagc
SV40 pA/pcDNA3.1(−) P5 tacagacatgataagatacat
P6 cctcggcctcagacgtaaacttgtttattgcagc
CMV/pcDNA3.1(−) P7 caacttcggaggtcgaccagtactccgggcgacaagagctctgcttatatag
P8 ttaagatctgtacatcaatgggcgtgg
MPI/pYA4924 P9 gctgcaataaacaagtttacgtctgaggccgagg
P10 tggtcgacctccgaagttgggggggtgagacggatccgtctctacctatctccaggtcc
GFP cassette/pYA4332 BglII-lpp taaagatctttgttgtgtgaattaat
BglII-5ST1T2 ttaagatcttccattattgaagcatt
PB1/pYA4384 AarI-1 PB1 taacacctgcagtcaggtagtagaaacaaggcatt
AarI-2 PB1 ttacacctgcgactggggagcgaaagcaggcaaac
PB2/pYA4383 AarI-1 PB2 taacacctgcagtcaggtagtagaaacaaggtcgt
AarI-2 PB2 ttacacctgcgactggggagcgaaagcaggtcaat
PA/pYA4385 BsmBI-1PA taacgtctctaggtagtagaaacaaggtact
BsmBI-2PA ttacgtctctggggagcgaaagcaggtactg
NP/pYA4386 BsmBI-1NP taacgtctctaggtagtagaaacaagggtat
BsmBI-2NP ttacgtctctggggagcaaaagcagggtaga
HA/pYA4388 BsmBI-1HA taacgtctctaggtagtagaaacaagggtg
BsmBI-2HA ttacgtctctggggagcaaaagcaggggaa
NA/pYA4389 AarI-1NA taacacctgcagtcaggtagtagaaacaaggagtt
AarI-2NA ttacacctgcgactggggagcgaaagcaggagttt
M/pYA4390 BsmBI-1 M taacgtctctaggtagtagaaacaaggtagt
BsmBI-2 M ttacgtctctggggagcaaaagcaggtagat
NS/pYA4391 BsmBI-1NS taacgtctctaggtagtagaaacaagggtgt
BsmBI-2NS ttacgtctctggggagcaaaagcagggtgac
NP cassette /pYA4968 PmlI-NP cacgtgtacatcaatgggcgtggatagcg
SmaI-NgoMIV-NP cccgggatagccggcagacatgataagatacat
PA cassette/pYA4967 NgoMIV-PA taagccggcgtacatcaatgggcgtggat
GGG-AsiSI-PA gggatagcgatcgcagacatgataagatacat
PB1 cassette/pYA4965 AsiSI-PB1 gcgatcgcgtacatcaatgggcgtggat
SmaI-NotI-PB1 cccgggatagcggccgcagacatgataagatacat
PB2 cassette/pYA4966 NotI-PB2 taagcggccgcgtacatcaatgggcgtggat
GGG-BssHII-PB2 gggatagcgcgcagacatgataagatacat
NS cassette/pYA4972 BssHII-NS gcgcgcgtacatcaatgggcgtggatag
SmaI-KpnI-NS cccgggataggtaccagacatgataagatacat
M cassette/pYA4971 KpnI-M taaggtaccgtacatcaatgggcgtggat
GGG-PacI-M gggatattaattaacagacatgataagatacat
NA cassette/pYA4970 PacI-NA ttaattaagtacatcaatgggcgtggatag
SmaI-SbfI-NA cccgggatacctgcaggcagacatgataagatacat
HA cassette/pYA4969 SbfI-HA taacctgcagggtacatcaatgggcgtggat
GGG-HA gggcagacatgataagatacattgatg
GFP cassette/pYA4964b GGG-5ST1T2 gggtccattattgaagcatttatcaggg
SbfI-lpp taacctgcaggttgttgtgtgaattaatttgt
KpnI-lpp taaggtaccttgttgtgtgaattaatttgt
NotI-lpp taagcggccgcttgttgtgtgaattaatttgt
NgoMIV-lpp taagccggcttgttgtgtgaattaatttgt
PacI-lpp taattaattaattgttgtgtgaattaatttgt
BssHII-lpp taagcgcgcttgttgtgtgaattaatttgt
AsiSI-lpp taagcgatcgcttgttgtgtgaattaatttgt
  1. aThe restriction enzyme sites or the GGG (corresponding to 3′- triple C of the PA, PB2, M, HA, and GFP cassettes in Fig. 2) were underlined
  2. bPrimer GGG-5ST1T2 was paired with each of the other 7 primers for amplifying GFP cassette from pYA4964