Skip to main content

Table 2 Sequences of the primers and probe used in this study

From: Development of a real-time reverse transcription loop-mediated isothermal amplification method for the rapid detection of porcine epidemic diarrhea virus

Application Primer name Length(bp) Primer/probe sequence(5′ to 3′)
Set 1 primers for RT-LAMP M1-F3 20 GGACACATTCTTGGTGGTCT
M1-B3 20 CCAACACGTCCGTAGACAAT
M1-FIP 42 TGGTGCTCCAAGCACTGGAATGACGCGCTTCTCACTACTTCT
M1-BIP 40 AAGGTTGCTACTGGCGTACAGGTTGTAGTGGCCTTGGCGA
Set 2 primers for RT-LAMP M2-F3 18 ACAGACGCGCTTCTCACT
M2-B3 20 CCAACACGTCCGTAGACAAT
M2-FIP 39 AGCGTTACACCAGTTGGTGCTCTTCTGTGATGGGCCGAC
M2-BIP 40 AAGGTTGCTACTGGCGTACAGGTTGTAGTGGCCTTGGCGA
Set 3 primers for RT-LAMP M3-F3 19 GCGCAGGACACATTCTTGG
M3-B3 19 TTGGCGACTGTGACGAAAT
M3-FIP 40 GGAATGCAGACCTGTCGGCCTCAATCCTGAAACAGACGCG
M3-BIP 41 TGGAGCACCAACTGGTGTAACGGTACGCCAGTAGCAACCTT
Set 4 primers for RT-LAMP M4-F3 18 CCGACAGGTCTGCATTCC
M4-B3 20 CCAGTGCCAGATGAAGCATT
M4-FIP 42 CCTGTACGCCAGTAGCAACCTTGAGCACCAACTGGTGTAACG
M4-BIP 41 ATTTCGTCACAGTCGCCAAGGCGACTGAACGACCAACACGT
Set 5 primers for RT-LAMP M5-F3 20 AGCTTTCAGGTCAATTGGGT
M5-B3 20 GGAGTGTTAGCGTTACACCA
M5-FIP 42 TGCGCCACAACCGAATGCTATTCAGCATCCTTATGGCTTGCA
M5-BIP 41 TCAATCCTGAAACAGACGCGCTTGCTCCAAGCACTGGAATG
RT-PCR P1 21 TTCCCAGCGTAGTTGAGATTG
P2 21 CGAAGTGGCTCTGGATTTGTT
real-time RT-PCR PED-NF 24 CGCAAAGACTGAACCCACTAATTT
PED-NR 24 TTGCCTCTGTTGTTACTTGGAGAT
PED-Cy5 24 Cy5-TGTTGCCATTGCCACGACTCCTGC-BHQ3