Skip to main content

Advertisement

Table 3 Primers used for qRT-PCR

From: Differential expression of miRNAs in enterovirus 71-infected cells

Primer name Forward primer sequence (5′–3′) Product size (bp)
Up-regulated miRNAs
hsa-miR-4530 CAGGACGGGAGCGAAAA 66
hsa-miR-4492 CTGGGCGCGCGCCAAA 66
hsa-miR-4505 CTGGGCTGGGACGGAAAA 68
hsa-miR-6125 GCGGAGCGGCGGAAAA 67
hsa-miR-494-3p GAAACATACACGGGAAACCTCAA 74
hsa-miR-638 GGGCGGGTGGCGGCCTAAA 69
hsa-miR-6743-5p AGGGACGGGTGGCCCA 69
hsa-miR-4459 GCGGAGGAGGTGGAGAAA 68
Down-regulated miRNAs
hsa-miR-29a-3p CACCATCTGAAATCGGTTAA 72
hsa-miR-4443 TGGAGGCGTGGGTTTTAAA 69
hsa-miR-27b-5p AGAGCTTAGCTGATTGGTGAACAA 75