Skip to main content

Advertisement

Table 1 Summary of the most significantly differentally expressd miRNA

From: Differential expression of miRNAs in enterovirus 71-infected cells

miR-name Fold change P values Target sequence (5′ to 3′)
Up-regulated miRNAs
hsa-miR-4800-3p 28.83 4.19E-03 CAUCCGUCCGUCUGUCCAC
hsa-miR-4530 12.00 4.64E-03 CCCAGCAGGACGGGAGCG
hsa-miR-4492 9.61 7.36E-03 GGGGCUGGGCGCGCGCC
hsa-miR-4507 8.88 3.76E-02 CUGGGUUGGGCUGGGCUGGG
hsa-miR-3620-5p 8.86 1.18E-02 GUGGGCUGGGCUGGGCUGGGCC
hsa-miR-4505 8.72 6.33E-03 AGGCUGGGCUGGGACGGA
hsa-miR-1587 8.54 2.03E-02 UUGGGCUGGGCUGGGUUGGG
hsa-miR-7108-5p 8.19 2.11E-02 GUGUGGCCGGCAGGCGGGUGG
hsa-miR-6791-5p 6.14 2.63E-02 CCCCUGGGGCUGGGCAGGCGGA
hsa-miR-6125 5.71 2.61E-02 GCGGAAGGCGGAGCGGCGGA
hsa-miR-494-3p 5.49 3.58E-02 UGAAACAUACACGGGAAACCUC
hsa-miR-1973 5.11 4.13E-04 ACCGUGCAAAGGUAGCAUA
hsa-miR-6729-5p 4.96 2.12E-02 UGGGCGAGGGCGGCUGAGCGGC
hsa-miR-638 4.61 1.17E-02 AGGGAUCGCGGGCGGGUGGCGGCCU
hsa-miR-3960 4.15 1.55E-02 GGCGGCGGCGGAGGCGGGGG
hsa-miR-6126 4.05 3.70E-02 GUGAAGGCCCGGCGGAGA
hsa-miR-4787-5p 4.04 1.08E-02 GCGGGGGUGGCGGCGGCAUCCC
hsa-miR-8072 4.04 2.07E-02 GGCGGCGGGGAGGUAGGCAG
hsa-miR-6085 3.90 1.49E-02 AAGGGGCUGGGGGAGCACA
hsa-miR-6779-5p 3.85 1.75E-02 CUGGGAGGGGCUGGGUUUGGC
hsa-miR-6087 3.49 1.02E-02 UGAGGCGGGGGGGCGAGC
hsa-miR-4707-5p 3.33 1.81E-02 GCCCCGGCGCGGGCGGGUUCUGG
hsa-miR-7704 3.26 4.44E-03 CGGGGUCGGCGGCGACGUG
hsa-miR-3196 3.25 8.02E-03 CGGGGCGGCAGGGGCCUC
hsa-miR-6743-5p 3.03 6.81E-03 AAGGGGCAGGGACGGGUGGCCC
hsa-miR-4466 2.94 1.88E-02 GGGUGCGGGCCGGCGGGG
hsa-miR-3665 2.77 3.44E-02 AGCAGGUGCGGGGCGGCG
hsa-miR-4497 2.71 1.41E-02 CUCCGGGACGGCUGGGC
hsa-miR-6803-5p 2.62 3.88E-02 CUGGGGGUGGGGGGCUGGGCGU
hsa-miR-5787 2.24 2.21E-02 GGGCUGGGGCGCGGGGAGGU
hsa-miR-7641 2.09 2.70E-02 UUGAUCUCGGAAGCUAAGC
hsa-miR-4298 2.00 3.56E-02 CUGGGACAGGAGGAGGAGGCAG
hsa-miR-4436b-3p 1.99 1.04E-02 CAGGGCAGGAAGAAGUGGACAA
hsa-miR-4459 1.74 8.61E-03 CCAGGAGGCGGAGGAGGUGGAG
hsa-miR-4488 1.63 4.31E-02 AGGGGGCGGGCUCCGGCG
hsa-miR-4739 1.45 1.30E-02 AAGGGAGGAGGAGCGGAGGGGCCCU
Down-regulated miRNAs
hsa-let-7a-5p 0.70 3.40E-03 UGAGGUAGUAGGUUGUAUAGUU
hsa-miR-29a-3p 0.69 1.20E-02 UAGCACCAUCUGAAAUCGGUUA
hsa-miR-127-3p 0.67 4.16E-02 UCGGAUCCGUCUGAGCUUGGCU
hsa-miR-196a-5p 0.59 3.35E-02 UAGGUAGUUUCAUGUUGUUGGG
hsa-miR-378c 0.58 4.53E-02 ACUGGACUUGGAGUCAGAAGAGUGG
hsa-let-7b-5p 0.55 8.67E-03 UGAGGUAGUAGGUUGUGUGGUU
hsa-miR-4443 0.32 1.17E-03 UUGGAGGCGUGGGUUUU
hsa-miR-27b-5p 0.21 4.34E-02 AGAGCUUAGCUGAUUGGUGAAC
hsa-miR-1538 0.16 2.10E-02 CGGCCCGGGCUGCUGCUGUUCCU