Skip to main content

Advertisement

Table 1 The oligonucleotides used for construction of amiRNA expression vectors in this study

From: Inhibition of porcine reproductive and respiratory syndrome virus infection by recombinant adenovirus- and/or exosome-delivered the artificial microRNAs targeting sialoadhesin and CD163 receptors

Target miRNA Start Double-stranded oligonucleotide sequence (5′→3′)
Sn 1 161 TGCTGAGTACCAGATGGCTGTGATGC GTTTTGGCCACTGACTGACGCATCACACATCTGGTACT
CCTGAGTACCAGATGTGTGATGCGTCAGTCAGTGGCCAAAACGCATCACAGCCATCTGGTACTC
2 367 TGCTGTTTGACATCTGACCAGCGGTT GTTTTGGCCACTGACTGACAACCGCTGCAGATGTCAAA
CCTGTTTGACATCTGCAGCGGTTGTCAGTCAGTGGCCAAAACAACCGCTGGTCAGATGTCAAAC
3 378 TGCTGACAACTGTGCCTTTGACATCT GTTTTGGCCACTGACTGACAGATGTCAGGCACAGTTGT
CCTGACAACTGTGCCTGACATCTGTCAGTCAGTGGCCAAAACAGATGTCAAAGGCACAGTTGTC
4 458 TGCTGAGTTGAAGTCCACCTCCATGC GTTTTGGCCACTGACTGACGCATGGAGGGACTTCAACT
CCTGAGTTGAAGTCCCTCCATGCGTCAGTCAGTGGCCAAAACGCATGGAGGTGGACTTCAACTC
5 461 TGCTGAGCAGTTGAAGTCCACCTCCA GTTTTGGCCACTGACTGACTGGAGGTGCTTCAACTGCT
CCTGAGCAGTTGAAGCACCTCCAGTCAGTCAGTGGCCAAAACTGGAGGTGGACTTCAACTGCT
6 669 TGCTGATCTCCTTCTGCATCCTGCGT GTTTTGGCCACTGACTGACACGCAGGACAGAAGGAGAT
CCTGATCTCCTTCTGTCCTGCGTGTCAGTCAGTGGCCAAAACACGCAGGATGCAGAAGGAGATC
7 1148 TGCTGAGAAGTAGAAGCCCGAATCCG GTTTTGGCCACTGACTGACCGGATTCGCTTCTACTTCT
CCTGAGAAGTAGAAGCGAATCCGGTCAGTCAGTGGCCAAAACCGGATTCGGGCTTCTACTTCTC
8 1476 TGCTGTTCCCAAGAGAACTGCTGGCT GTTTTGGCCACTGACTGACAGCCAGCATCTCTTGGGAA
CCTGTTCCCAAGAGATGCTGGCTGTCAGTCAGTGGCCAAAACAGCCAGCAGTTCTCTTGGGAAC
9 1510 TGCTGTGCATTGGCATGGAAGTCCAG GTTTTGGCCACTGACTGACCTGGACTTATGCCAATGCA
CCTGTGCATTGGCATAAGTCCAGGTCAGTCAGTGGCCAAAACCTGGACTTCCATGCCAATGCAC
CD163 1 94 TGCTGAGAACTAGTGACCAAGCAGGC GTTTTGGCCACTGACTGACGCCTGCTTTCACTAGTTCT
CCTGAGAACTAGTGAAAGCAGGCGTCAGTCAGTGGCCAAAACGCCTGCTTGGTCACTAGTTCTC
2 527 TGCTGTGAAGTTGTCATCACACACTG GTTTTGGCCACTGACTGACCAGTGTGTTGACAACTTCA
CCTGTGAAGTTGTCAACACACTGGTCAGTCAGTGGCCAAAACCAGTGTGTGATGACAACTTCAC
3 645 TGCTGCATACAAGATCATCAAACCA GGTTTTGGCCACTGACTGACCTGGTTTGGATCTTGTATG
CCTGCATACAAGATCCAAACCAGGTCAGTCAGTGGCCAAAACCTGGTTTGATGATCTTGTATGC
4 740 TGCTGTTAAGCAAATCACTCCAGCAT GTTTTGGCCACTGACTGACATGCTGGAGATTTGCTTAA
CCTGTTAAGCAAATCTCCAGCATGTCAGTCAGTGGCCAAAACATGCTGGAGTGATTTGCTTAAC
5 768 TGCTGACCACTCTCAGTTTCAGGTCT GTTTTGGCCACTGACTGACAGACCTGACTGAGAGTGGT
CCTGACCACTCTCAGTCAGGTCTGTCAGTCAGTGGCCAAAACAGACCTGAAACTGAGAGTGGTC
6 807 TGCTGTTCACTTCCAATCTTCCTGAA GTTTTGGCCACTGACTGACTTCAGGAATTGGAAGTGAA
CCTGTTCACTTCCAATTCCTGAAGTCAGTCAGTGGCCAAAACTTCAGGAAGATTGGAAGTGAAC
7 961 TGCTGAACACTGTCAAGCCAAATGTG GTTTTGGCCACTGACTGACCACATTTGTTGACAGTGTT
CCTGAACACTGTCAACAAATGTGGTCAGTCAGTGGCCAAAACCACATTTGGCTTGACAGTGTTC
8 998 TGCTGTACACTGCCAGAGAGCAGACT GTTTTGGCCACTGACTGACAGTCTGCTCTGGCAGTGTA
CCTGTACACTGCCAGAGCAGACTGTCAGTCAGTGGCCAAAACAGTCTGCTCTCTGGCAGTGTAC
9 1325 TGCTGAATTCTTGCAGTCCCAAAGAG GTTTTGGCCACTGACTGACCTCTTTGGCTGCAAGAATT
CCTGAATTCTTGCAGCCAAAGAGGTCAGTCAGTGGCCAAAACCTCTTTGGGACTGCAAGAATTC
10 1486 TGCTGTAGTGACGAGACAAGCACAGC GTTTTGGCCACTGACTGACGCTGTGCTTCTCGTCACTA
CCTGTAGTGACGAGAAGCACAGCGTCAGTCAGTGGCCAAAACGCTGTGCTTGTCTCGTCACTAC
Control amiRcon   TGCTGTAGTGACGAGACAAGCACAGC GTTTTGGCCACTGACTGACGCTGTGCTTCTCGTCACTA
CCTGTAGTGACGAGAAGCACAGCGTCAGTCAGTGGCCAAAACGCTGTGCTTGTCTCGTCACTAC
  1. The candidate amiRNAs were predicted by following the instructions for the web-based Block-iTTM RNAi designer. The mature amiRNA and forward primer sequences for the detection of amiRNAs in rAd-transduced cells are indicated as italics.