Skip to main content

Advertisement

Table 4 The primer sequence of the complete genome sequence

From: Characterization of one sheep border disease virus in China

Amplified fragments primer Primer sequences(5'- > 3') Location (bp) Fragment size
F1 BVDV-F GCCATGCCCTTAGTAGGACTAGC 1 ~ 23 2200 bp
BDV-2300R TATCAGGAAGGCTGTTGTCGA 2255 ~ 2273
F2 BDV-2240 F TTGGTGGCCATACGAGACAAC 2144 ~ 2164 1900 bp
BDV-4140R TGTCAAGATGAAGAATAGGGG 4023 ~ 4043
F3 BDV-4010 F AAGCAGTGGCTACAATCCGTG 3912 ~ 3932 1950 bp
BDV-5960R CATCTCTCCAATCCTCAGGTT 5865 ~ 5885
F4 BDV-5940 F GCAGAAGCACCCTAGCATAGC 5840 ~ 5860 2000 bp
BDV-7940R TATGACTACGCTCTCCAGCCG 7929 ~ 7945
F5 BDV-7885 F GCCTTACGCATCTCAAGCCCTC 7787 ~ 7808 2200 bp
BDV-10110R TGCCTCGTATGGGTGTATTTTC 10001 ~ 10022
F6 BDV-10010 F CAGAGCATATGGTGTCAGCATATCAG 9907 ~ 9932 2300 bp
BDV-12326R GGGGCTGTTAGGGTTTTTCCTTAATCC 12201 ~ 12227