Skip to main content

Table 4 The primer sequence of the complete genome sequence

From: Characterization of one sheep border disease virus in China

Amplified fragments primer Primer sequences(5'- > 3') Location (bp) Fragment size
F2 BDV-2240 F TTGGTGGCCATACGAGACAAC 2144 ~ 2164 1900 bp
F3 BDV-4010 F AAGCAGTGGCTACAATCCGTG 3912 ~ 3932 1950 bp
F4 BDV-5940 F GCAGAAGCACCCTAGCATAGC 5840 ~ 5860 2000 bp
F5 BDV-7885 F GCCTTACGCATCTCAAGCCCTC 7787 ~ 7808 2200 bp