Skip to main content

Table 5 List of primers used with the real-time RT-PCR HRM assay and the end-point multiplex RT-PCR protocol

From: Real-time RT-PCR high-resolution melting curve analysis and multiplex RT-PCR to detect and differentiate grapevine leafroll-associated virus 3 variant groups I, II, III and VI

Primer pair Sequence (5'-3') Target region Amplicon size (bp)
LR3.HRM1.F TAGACGTTAAAGATGTGAAGCG GLRaV-3 ORF1a 167
LR3.HRM1.R TCGTACACATCCACCATA   
LR3.HRM2.F GTCCTAGATTCGGATTTTGTCG GLRaV-3 ORF1a 231
LR3.HRM2.R GAATACTCTTCGCCCTATC   
LR3.HRM3.F CTGGTTGCTTTCGAGGTATATGAG GLRaV-3 ORF1b 295
LR3.HRM3.R CACTTCAAGGTGTTGCGCTT   
LR3.HRM4.F TAATCGGAGGTTTAGGTTCC GLRaV-3 ORF4 226
LR3.HRM4.R GTCGGTTCGTTAACAACAC   
LR3.HRM5.F TGTGTAAGAAGGTTATGGG GLRaV-3 ORF6 224
LR3.HRM5.R TACTGCCTTACCGGGTTTTC   
LR3.HRM6.F GTCACCAGGTGTTCCAAACC GLRaV-3 ORF1a 305
LR3.HRM6.R AACGCCCTGTATGTCCTCTC   
LR3_Universal_F TAAATGCTCTAGTAGGATTC GLRaV-3 5'UTR  
621_430R TAACCCAACACGACGATGAG GLRaV-3 5'UTR 429a
623_564R CTCACGCTAAACACACCAAG GLRaV-3 5'UTR 563a
PL20_315R GTTTGTAACAAAGAAACACG GLRaV-3 5'UTR 314a
GH11_180R CCAAAACGAAGACGAAAAGAAGAG GLRaV-3 5'UTR 179a
LR_ORF1aR CGTCCGCTTCACCCCTTTGG GLRaV-3 ORF1a  
Vv_Actin_F [32] CTTGCATCCCTCAGCACCTT V. vinifera predicted actin-7 82
Vv_Actin_R [32] TCCTGTGGACAATGGATGGA   
  1. aAmplicon size if use together with LR_Universal_F.