Skip to main content

Table 1 List of primers for quantitative RT-PCR

From: Deciphering the differential response of two human fibroblast cell lines following Chikungunya virus infection

Reference Gene Primer 5' modification Sequence (5' to 3') 3' modification
Primer and probes used for the one-step qRT-PCR from TAKARA
NM_002201.4 ISG20 ISG20-636 F   CTGTTGTGGCGTGAGGCCA  
   ISG20-764R   TGCCCTCGCATCTTCCACC  
   ISG20-688P HEX TGCTGAGTGAGCGCCTCCTGC BHQ-1
NM_002201.4 ISG54 ISG54-76 F   GGTCTCTTCAGCATTTATTGGTG  
   ISG54-219R   TGCCGTAGGCTGCTCTCCA  
   ISG54-124P FAM TGCAGCTGCCTGAACCGAGC BHQ-1
NM_001548.3 ISG56 ISG56-131 F   GCCTAATTTACAGCAACCATGAG  
   ISG56-347R   GGCCTTTCAGGTGTTTCACATA  
   ISG56-215P HEX TGGGAGTTATCCATTGATGACGATG BHQ-1
NM_014314.3 RIG-I RIG-I-237 F   AGCTACATGGCCCCCTGGT  
   RIG-I-397R   GCATGGTCTAGGGCATCCAA  
   RIG-I-351P HEX CAGGAGGAAGGCTGGTTCCGT BHQ-1
NM_002046 GAPDH GAPDH-F   AGCCTCAAGATCATCAGCAATG  
   GAPDH-R   CTGTGGTCATGAGTCCTTCCA  
   GAPDH-P HEX CCAACTGCTTAGCACCCCTGGC BHQ1
Primers used for the RT-qPCR with BRYT Green
NM_002176.2 IFN-β F GTTCGTGTTGTCAACATGACCA   
   R TCAATTGCCACAGGAGCTTCT   
NM_016562.3 TLR7 F CCACAACCAACTGACCACTG   
   R CCACCAGACAAACCACACAG   
NM_002046.3 GAPDH F GCACCGTCAAGGCTGAGAAC   
   R GCCTTCTCCATGGTGGTGAA