Skip to main content

Table 2 Primer sequences used in this study

From: Detection of Merkel cell polyomavirus in cervical squamous cell carcinomas and adenocarcinomas from Japanese patients

PCR analysis and DNA sequencing analysis
Target gene Primer name Sequence (5’ → 3’) Predicted product size
MCPyV LT LTsh-F GATCAGGAGGATTCAGCTTCG 242 bp
  LTsh-R CAGAGGATGAGGTGGGTTCC  
MCPyV VP1 VP1-F TTTGCCAGCTTACAGTGTGG 352 bp
  VP1-R TGGATCTAGGCCCTGATTTTT  
HPV L1 GP5+ TTTGTTACTGTGGTAGATACTAC 150 bp
  GP6+ GAAAAATAAACTGTAAATCATATTC  
Human β-globin β-globin-F ACACAACTGTGTTCACTAGC 110 bp
  β-globin-R CAACTTCATCCACGTTCACC  
Real-time PCR analysis   
Target gene Primer sequence (5’ → 3’) Probe sequence (5’ → 3’)
MCPyV ST GCAAAAAAACTGTCTGACGTGG FAM-TATCAGTGCTTTATTCTTTGGTTTGGATTTCCTCCT-TAMRA
  CCACCAGTCAAAACTTTCCCA  
Human RNase P AGATTTGGACCTGCGAGCG FAM-TTCTGACCTGAAGGCTCTGCGCG-TAMRA
  GAGCGGCTGTCTCCACAAGT