Skip to main content

Table 1 Sequences of LAMP primers used in the study

From: Loop-mediated isothermal amplification for the detection of goose circovirus

Primer Sequence 5’ – 3’ Length (nt) Localisation in GCV genome
F3 CTGCGGTGTCTTCTGCTT 18 1080-1097
B3 AGTGGAACGTAGACCCCTAC 20 1294-1313
BIP (B1c + B2) TGTTGGATGGTTGGTTTCGGGATTTT GAAAACGTGGTCACCTCACA 46 1214-1235, 1257-1276
FIP (F1c + F2) ACACCCCAGGAGGAAGACAACTTTTT TAGTGACATGCCCATTCCGT 46 1157-1178, 1102-1121
LF ATTCAAGACAACGTAGTATTCT 22 1122-1143
LB CAAATACTCTTTTGTGGTATC 21 1236-1256
  1. F3 – forward outer primer, B3 – forward backward primer, FIP – forward inner primer (F1c + F2), BIP – backward inner primer (B1c + B2), LF – forward loop primer, LB – backward loop primer, TTTT – thymine linker.