Skip to main content

Table 2 Primer sequences used in plasmid construction

From: A rapid method to screen putative mRNA targets of any known microRNA

Genes inserted Sequences
MiR-UL112-1 F: 5'-CGCGGATCC TCAGGTACTCGCAGGTGTGC
  R: 5'-CCCAAGCTT GTTGCCTGGACGCCTGGGCGCGA
HCMV IE72 F:5'-GGACTAGT ACTATTGTATATATATATCAGT
  R:5'-CCCAAGCTT CGGTTTCACAGGCGTGACACGTT
Homo sapiens zinc finger protein 36, C3H type-like 1 (ZFP36L1) F:5'-GGACTAGT AGGCCTTTCACAACTAGGACTGA
  R:5'-CCCAAGCTT AAACTGCAAATAGTCGTTACAAA
Homo sapiens transportin 1 F:5'-GGACTAGT TCTAATACACTTAAGCTGCAGT
  R:5'-CCCAAGCTT GCTTCTTCACATCCACTGCGGAGT
Homo sapiens ribosomal protein L7a F:5'-GGACTAGT GAAGACAAAGGCGCTTTGGCTA
  R:5'-CCCAAGCTT ATGTACAGAAAACTCAACAGT
Homo sapiens interleukin 32 F:5'-GGACTAGT AGATACTGACACCACCTTTGCCCT
  R:5'-CCCAAGCTT CATGGTATCTCCCCTGCCAG
Homo sapiens mRNA for putative NFkB activating protein F:5'-GGACTAGT TGAACACAGAAAGTCTAAGAGGA
  R:5'-CCCAAGCTT GCTAATTAAACTTTGATTTTATTATG
HCMV UL17/18 F:5'-GGACTAGT TACCAGCGGTTACGCACCGAG
  R:5'-CCCAAGCTT AACAGTTCCTCGGACATGATCA
HCMV IE86 F:5'-GGACTAGT AGTCCACGGACCGCTCGGTCT
  R:5'-CCCAAGCTT TGCGCTCACCCGGCGTTCTC
  1. Note: sequences recognized by restriction endonuclases are in bold.