Skip to main content

Table 3 Primers for sequencing of genome of HPIV-3 LZ22 strain

From: Identification of a natural human serotype 3 parainfluenza virus

Fragment
(Positions)
Primer
(5'-3')
Sequence
NP NPS ACCAAACAAGAGAAGAGACTTGTTTGG
(1-1843) NPA TTCCTCTTCCCAAGAATCCATGATTTG
PP PPS GGACGAAATAGACGATCTGTTCAATGC
(1616-3485) PPA CTGTTCATTGACTTTGAGTGGTAATGG
M MS TCACTAGTTGCAGTCATCAACAACAGC
(3452-5183) MA CCCTTTGGGACTATTGACCAATACACC
F FS TGCAATTTTCCAACCTTCTTTACCTGG
4724-7104) FA AAGAAGCCTTGTATTCACTCCTGACTG
HN HNS AAATCGAGTGGATCAAAATGATAAGCC
(6644-8744) HNA TGTGTAATTGTGCTATTCTACCTTTAACG
L1 L1S TGTTCAAAACAGAGATTCCAAAAAGCTGC
(8489-10684) L1A TCCAAATAGAGCCGTTGATTCATATCTCC
L2 L2S CTGGAGATATGAATCAACGGCTCTATTTG
(10654-12958) L2A AATTGCATGTATAATGTCAGTATCATCCC
L3 L3S TATTGGGATGATACTGACATTATACATGC
(12926-15461) L3A ACCAAACAAGAGAAGAACTCTGCTTGGTA
3'RACE (617) S TTGAACATAGAGCACAGACTGG
  A* TACCGTCGTTCCACTAGTGATTT
(399) Sn GCTGATACGGATTCAGATTCATTCAAATTATC
  An* CGCGGATCCTCCACTAGTGATTTCACTATAGG
5'RACE S* CATGGCTACATGCTGACAGCCTA
(15088) A AATAGCTCCTAAACATGATGGATACCC
  Sn CGCGGATCCACAGCCTACTGATGATCAGTCGATG
(15423) An TGACATCTGCATTACTTCCATTTGTTGTTAGG
  1. *Primers were supplied by manufacturer