Skip to main content

Table 1 Oligonucleotide sequences used for detection of HAdV

From: Effective detection of human adenovirus in hawaiian waters using enhanced pcr methods

Primer Sequence (5'→ 3')a +/-b Target Ampliconsize (bp) References
Q-Padv-F AACGGCCGCTACTGCAAG + Swine AdV hexon 68 Hundesa et al., 2009 [24]
Q-Padv-R AGCAGCAGGCTCTTGAGG -    
hex1deg (outer) GCCSCARTGGKCWTACATGCACATC + Hexon 301 Allard et al., 2001 [25]
hex2deg (outer) CAGCACSCCICGRATGTCAAA -    
nehex3deg (inner) GCCCGYGCMACIGAIACSTACTTC +   171  
nehex4deg (inner) CCYACRGCCAGIGTRWAICGMRCYTTGTA -    
ADV-F GCCACGGTGGGGTTTCTAAACTT + Hexon 131 Gunson et al., 2009 [26]
ADV-R GCCCCAGTGGTCTTACATGCACATC -    
XuHex1 TTCCCCATGGCICAYAACAC + Hexon 482 Xu et al. 2000 [27]
XuHex2 CCCTGGTAKCCRATRTTGTA -    
hexDEGF CAGGACGCCTCGGRGTAYCTSAG + Hexon 103 Damen et al., 2008 [28]
hexDEGR GGAGCCACVGTGGGRTT -    
AdE1 TCCCTACGATGCAGACAACG + Fiber 967 Xu et al. 2000 [27]
AdE2 AGTGCCATCTATGCTATCTCC -    
AdF1 ACTTAATGCTGACACGGGCAC +   541-586  
AdF2 TAATGTTTGTGTTACTCCGCTC -    
AdF CWTACATGCACATCKCSGG + Hexon ~75 Hernroth et al., 2002 [29]
AdR CRCGGGCRAAYTGCACCAG -    
HAdV-ABCDEF-hexon25fc CARTGGKCDTACATGCACATC + Hexon   Kuo et al., 2009 [30]
HAdV-E-hexon373r CCAGRCTGTTGTAGGCAGTG -   349  
HAdV-F-hexon265r CCACGGCCAGCGTAAAGC -   241  
hexAA1885 (outer) GCCGCAGTGGTCTTACATGCACAGC + Hexon 300 Allard et al., 1990 [31]
hexAA1913 (outer) CAGCACGCCGCGGATGTCAAAGT -    
nehexAA1893 (inner) GCCACCGAGACGTACTTCAGCCTG + Hexon 142 Allard et al., 1992 [32]
nehexAA1905 (inner) TTGTACGAGTACGCGGTATCCTCGCGGTC -    
JTVFF AACTTTCTCTCTTAATAGACGCC + Fiber 117 Jothikumar et al., 2005 [33]
JTVFR AGGGGGCTAGAAAACAAAA -    
AdV1 (outer) CAAGATGGCCACCCCCTCG + hexon 329 Oh et al., 2003 [34]
AdV2 (outer) CGATCCAGCACGCCGCGGATGTC -    
AdV3 (inner) AATGGTCTTACATGCACAT +   253  
AdV4 (inner) ACCCGGTTGTCGCCCACGGCCAG -    
  1. a. R = A+G; Y = C+T;S = C+G;W = A+T;H = A+C+T;B = C+G+T;V = A+C+G;D = A+G+T;N = all
  2. b. Polarity
  3. c. Forward primer for both HAdV-E-hexon373r and HAdV-F-hexon265r