Skip to main content

Advertisement

Table 1 Sequences of primers used in Real Time PCR

From: Anti-apoptotic effect of HCV core gene of genotype 3a in Huh-7 cell line

No Gene Primer
1 Cap 3-F ATGGAAGCGAATCAATGGAC
2 Cap3-R GCCATGTCATCATCAACACC
3 Cap 8-F TATGGCACTGATGGACAGGA
4 Cap8-R GCAGAAAGTCAGCCTCATCC
5 Cap9-F ATGTCGTCCAGGGTCTCAAC
6 Cap9-R GGAAACTGTGAACGGCTCAT
7 Cap10-F AGTGACAGGTATGGGCGTTC
8 Cap10-R GCAGCACCTCAACTGTACCA
9 Cyt-F ATTGGCGGCTGTGTAAGAGT
10 Cyt-R CTGTCTACGGCACAGATGGA
11 p53-F GGCCCACTTCACCGTACTAA
12 p53-R GTGGTTTCAAGGCCAGATGT
13 GAPDH-F ACCACAGTCCATGCCATCAC
14 GAPDH-R TCCACCACCCTGTTGCTGTA