Skip to main content

Advertisement

Table 3 Transcription initiation and termination signals for all strain aG

From: Molecular characterization of China rabies virus vaccine strain

Gene or region Termination signal IGRs Initiation signal
3'leader/N ------ ------- AACACCTCT
N/P TGAAAAAAA CT AACACCCCT
P/M TGAAAAAAA CGAGC AACACCACT
M/G TGAAAAAAA CTATT AACATCCCT
G/L AGAAAAAAA CTGTAGATCGAAAGAGCAACTGGC AACACCTCT
L/5'trail CGAAAAAAA ------------------------------------------------- -------