Skip to main content

Advertisement

Table 1 Oligonucleotides for assembly of Circovirus Pcap cores and PCV-1 CLE

From: The porcine circovirus type 1 capsid gene promoter improves antigen expression and immunogenicity in a HIV-1 plasmid vaccine

PCV-1 CLE CLE-Fwd 5'-CTAGCTAGTGGGCCCGCCCGGTTGTGGGAAGAGCCAGTGG GCCCGTAATTTTG - 3'
  CLE-Rev 5'-CTAGCAAAATTACGGGCCCACTGGCTCTTCCCACAACCGG GCGGGCCCACTAG - 3'
PCV-1 Pcap core PCV-1 Fwd-A 5'-CTAGTCCTAGGCTGAACTTTTGAAAGTGAGCGGGAAGATGCAGCAGCGTG - 3'
  PCV-1 Fwd-B 5'-ATTGGAAGACAGCTGTACACGTCATAGTGGCTAGCA-3'
  PCV-1 Rev-C 5'-CTAGTGCTAGCCACTATGACGTGTACAGCTGTCTTCCAATCACGCTGCTGCATCTTCCCG-3'
  PCV-1/PCV-2 Rev-D 5'-CTCACTTTCAAAAGTTCAGCCTAGGA - 3'
PCV-2 Pcap core PCV-2 Fwd-P 5'-CTAGTCCTAGGCTGAACTTTTGAAAGTGAGCGGGAAAATGCAGAAGCGTG-3'
  PCV-2 Fwd-Q 5'-ATTGGAAGACTAATGTACACGTCATTGTGGCTAGCA-3'
  PCV-2 Rev-R 5'-CTAGTGCTAGCCACAATGACGTGTACATTAGTCTTCCAATCACGCTTCTGCATTTTCCCG-3'
BFDV Pcap core BFDV Fwd-W 5'-CTAGTCCTAGGGTTCCCAGATATCTACGTCAGGCATGGGCGGGGCTTAC-3'
  BFDV Fwd-X 5'-ATAATCTCTCGCTAGCTAGCAGCTAGCA-3'
  BFDV Rev-Y 5'-CTAGTGCTAGCTGCTAGCTAGCGAGAGATTATGTAAGCCCCGCCCATGC-3'
  BFDV Rev-Z 5'-CTGACGTAGATATCTGGGAACCCTAGGA-3