Skip to main content

Table 3 Putative phage regulatory elements identified by Phire analysis.

From: Salmonella Typhimurium-specific bacteriophage ΦSH19 and the origins of species specificity in the Vi01-like phage family

Putative phage regulatory elements
From To Sequence
56,300 56,319 TAGCCATGATGTAATTCCTC
79,926 79,945 CGGTCATGATGTATTTCCTT
99,487 99,506 TGGTCATGGTGTAGTTCCTT
101,431 101,450 GTCCCATGATGTATTTCTTC
104,872 104,891 TTTCCATCATGCATCTCCTT
109,822 109,841 TTGCCATAATATCATTCCTT
144,434 144,453 TTGCCATGATGTATTTCCTT