Skip to main content

Advertisement

Table 1 Details of LAMP and PCR primers

From: Loop-mediated isothermal amplification for detection of porcine circovirus type 2

Primer namea Genome positionb Sequence (5'→3')
F3 1355-1378 CTCCAGTGCTGTTATTCTAGATGA
B3 1160-1181 TTTCCAGCAGTTTGTAGTCTCA
FIP 1273-1295 1317-1335 GAAGGGCTGGGTTATGGTATGGC-TTTTc- ACAGCCCTCACCTATGACC
BIP 1240-1261 1182-1204 CCGCTACTTTACCCCCAAACCT-TTTTc- GCCACAGCTGATTTCTTTTGTTG
P3 1721-1742 GCGGATCCGTGACGTATCCAAG
P4 1025-1049 CCACTAGTATAGGGGTTAAGTGGGG
  1. a F3, forward outer primer; B3, backward outer primer; FIP, forward inner primer; BIP, backward inner primer. b Genome position according to the JS2003 complete genome sequence (GenBank accession number AY578327). c Both inner primers of FIP and BIP containing 2 binding regions and connected by a TTTT bridge