Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 Primers used for Amplification and DNA Sequencing of 5' UTR and NS5B regions in the identification of the HCV recombinant isolate (A, B) and subsequently for Amplification of Overlapping Products Across Entire HCV Recombinant Genome (1-7)

From: Naturally occurring genotype 2b/1a hepatitis C virus in the United States

Amplicon Nucleotide
Number
(H77 numbering
Accession no. AF009606)
Forward Primer (5'-3')
Normal: HCV genotyping primer; Bold: 1a primer;Italics: 2b primer
Reverse Primer (5'-3')
Normal: HCV genotyping primer; Bold: 1a primer;Italics: 2b primer
A 73-313 AAGCGTCTAGCCATGGCGT [7] CACTCGCAAGCACCCTATCA [6]
B 8256-8644 TATGAYACCCGCTGYTTTGACTC [8] GCNGARTAYCTVGTCATAGCCTC [8]
1 92-1295 TAGTATGAGTGTCGTACAGCCTCC TAGGGGACCAGTTCATCATCATATCCCATGCC
    ATGACTTTGGCCCACGCTCCCTGCATGG
2 1171-2240 TGGGAGACGTGTGTGGGGCCGTGATGATCGTGTCGCAGGC TTGGTATATCCAGTTGAGTTCATCCAGGTGCAACCGAACC
    TGCGGACAATCGATGCTCCACCCCCCCTACATACATCCG
3 2108-2980 TTTTAGGAAGCACCCAGATACCACCTATCTTAAGTGTGGAGC TTGCGCTTCTGCTCTAGTCAGAAAATACTGAAGCCACC
    TGACCTCAAACACAAGGCGTGGGTGTAGAATGACAGCC
4 2901-4793 TTAGTCTTGGCCGAGGCCCAGATTCAGCAATGGG TGGTTGTCTCAATGGTGAAGGTAGGGTCAAGGC
    TTCTCCCTCTACGTTGACTACGGGAGACAGC
5 4707-5789 ATAGACTGTAACACGTGTGTCACCC AGGACCTTCCCCAGTCCAACAC
6 5758-7285 CCACTGGCCAAACCCTCCTCTTCAACATA ACCACAGGTGGTTCGTAGTCGGGCTTTTTCCACGCC
7 7218-9296 GCGCGGCCGGACTACAACCCCCCGCTGATAGAGGCGTGG TTCATTATGAAAGGATCCGCGGGGTCGGGCACGAGACAGGCTGTG