Skip to main content

Advertisement

Table 2 Primers used for RT-PCR and real-time PCR

From: Prohibitin is overexpressed in Huh-7-HCV and Huh-7.5-HCV cells harboring in vitro transcribed full-length hepatitis C virus RNA

Name Forward primer (5'-3') Reverse primer (5'-3')
Prohibitin (RT-PCR, 835 bp) GAAGATCTATGGCTGCCAAAGTGTTTGAG CGGGATCCTCACTGGGGCAGCTGGA
Prohibitin (real-time PCR, 129 bp) AAACAGGTGGCTCAGCAGGAA CAGTGAGTTGGCAATCAGCTCAG
GAPDH (real-time PCR, 138 bp) GCACCGTCAAGGCTGAGAAC TGGTGAAGACGCCAGTGGA