Skip to main content

Table 1 Primers used in this study

From: Sequencing of bovine herpesvirus 4 v.test strain reveals important genome features

name Sequence Coordinates according to Genbank
Bo1 Fwd 5'- ATGGAGGGTGATGGATTCATG-3' 460-440a
Bo1 Rev 5'- TTAAGGCCTCATTCCAGGAAG-3' 272-292a
Bo5 Fwd 5'- GCTACAGAAAATGGCCAGTAAAG-3' 20366-20342a
Bo5 Rev 5'- TCATGTCCTGAGTGGGTCTATG-3' 19170-19191a
Bo6 Fwd 5'- ATGGTCATCCTAAATGCTCAAG -3' 20297-20318a
Bo6 Rev 5'- TCACCTAGTGTTGCAACCCC -3' 20497-20478a
Bo7 Fwd 5'- ATGGAGACAATTTCCATAAACTG -3' 20994-20972a
Bo7 Rev 5'- CTAGCTGGGGTAGAGTGATC -3' 20671-20690a
ORF67.5 Fwd 5'- ATGGCTGATGGTGATGTTTTAG -3' 93144-93123a
ORF67.5 Rev 5'- TCAATGTTTGTCCAGAGCACT -3' 92881-92901a
Bo12 Fwd 5'- ATGGGGGCGCTATTTGGGC -3' 97442-97460a
Bo12 Rev 5'- TCAACTGATGAAACCCACCC -3' 97525-97506a
Bo13 Fwd 5'- ATGCGTCTCGATGGCAAGC -3' 98838-98856a
Bo13 Rev 5'- CTATGGTTGTTTTTTAAAGAAAATC -3' 98981-98957a
ORF75 Fwd 5'- ATGTATCCCAGATACAGTAACA -3' 103606-103585a
ORF75 Rev 5'- TTACATTTTATTTTTCAGACACCA -3' 100274-100297a
prDNA Fwd 1 5'- GGAGCCCAAAACCAAAAGAG -3' 870-889b
prDNA Rev 1 5'- CTCTTTTGGTTTTGGGCTCC -3' 889-870b
prDNA Fwd 2 5'- CGTAGGCCTCACATTCAGC -3' 908-926b
prDNA Rev 2 5'- GCTGAATGTGAGGCCTACG -3' 926-908b
prDNA Fwd 3 5'- CGAGAGATGGTTCTTGCACA -3' 940-959b
prDNA Rev 3 5'- TGTGCAAGAACCATCTCTCG -3' 959-940b
BAC Rev 5'- TTGCCAATCCCAAAAAGAAG -3' 9859-9878c
  1. a according to Genbank JN133502 sequence (BoHV-4 V.test strain long unique region)
  2. b according to Genbank JN133504 sequence (BoHV-4 V.test strain prDNA inner region)
  3. c according to Genbank AY665170.1 sequence (pBeloBAC modified)