Skip to main content

Table 1 Sequences of primers for RT-PCR

From: Expression of il-23/th17 pathway in a murine model of coxsackie virus b3-induced viral myocarditis

Molecule Sequence (5' -3') length
IL-23 [GenBank: 83430] sense: 5'CTTCTCCGTTCCAAGATCCTTC 3'
antisense:5'ACGCACTAGGTTTGCCGAGTAGA3'
200 bp
IL-17[GenBank:16171] sense:5'GTCAATGCGGAGGGAAAG3'
antisense: 5'CACGAAGCAGTTTGGGAC 3'
349 bp
STAT3 [GenBank: 20848] sense: 5'CCCATATCGTCTGAAACTC3'
antisense: 5'TTGCTCCCTTCTGCTCT3'
188 bp
β-actin [GenBank:11461] sense:5'CCAGCCTTCCTTCTTGGGTAT3'
antisense: 5'TTGGCATAGAGGTCTTTACGG 3'
102 bp