Skip to main content

Table 1 Sequences

From: Effect of combined siRNA of HCV E2 gene and HCV receptors against HCV

Name Sequences
Scramble-antisense AACCTGCATACGCGACTCGACCCTGTCTC
Scramble-sense AAGTCGAGTCGCGTATGCAGGCCTGTCTC
CD81-B antisense AAGATGCCTACATAGAAGGTGCCTGTCTC
CD81-B sense AACACCTTCTATGTAGGCATCCCTGTCTC
LDL antisense AAATGCATCTCCTACAAGTGGCCTGTCTC
LDL sense AACCACTTGTAGGAGATGCATCCTGTCTC
E2si873-antisense AACAACTGAGCTTGCCATACTCCTGTCTC
E2si873-sense AAAGTATGGCAAGCTCAGTTGCCTGTCTC