Skip to main content

Table 1 Inserted sequences in miRNA-expressing plasmids

From: Effective inhibition of foot-and-mouth disease virus (FMDV) replication in vitro by vector-delivered microRNAs targeting the 3D gene

Name Inserted sequence (5'-3') Position in 3D gene
3D657 Top strand TGCTGAATCTTTGCCAATCAACGTCAGTTTTGGCCACTGACTGACTGACGTTGTGGCAAAGATT 657-678
  Bottom strand CCTGAATCTTTGCCACAACGTCAGTCAGTCAGTGGCCAAAACTGACGTTGATTGGCAAAGATT C  
3D715 Top strand TGCTGATCAAAGGCCGAATAGTCCACGTTTTGGCCACTGACTGACGTGGACTACGGCCTTTGAT 715-736
  Bottom strand CCTGATCAAAGGCCGTAGTCCACGTCAGTCAGTGGCCAAAACGTGGACTATTCGGCCTTTGAT C  
3D983 Top strand TGCTGAGATCATGGTGTAAGTGTCCAGTTTTGGCCACTGACTGACTGGACACTCACCATGATCT 983-1004
  Bottom strand CCTGAGATCATGGTGAGTGTCCAGTCAGTCAGTGGCCAAAACTGGACACTTACACCATGATCT C  
3D1311 Top strand TGCTGTCAAAGAGACGCCGGTACTCGGTTTTGGCCACTGACTGACCGAGTACCCGTCTCTTTGA 1311-1332
  Bottom strand CCTGTCAAAGAGACGGGTACTCGGTCAGTCAGTGGCCAAAACCGAGTACCGGCGTCTCTTTGA C  
Negative control Top strand TGCTGAAATGTACTGCGCGTGGAGACGTTTTGGCCACTGACTGACGTCTCCACGCAGTACATTT NO
  Bottom strand CCTGAAATGTACTGCGTGGAGACGTCAGTCAGTGGCCAAAACGTCTCCACGCGCAGTACATTTc  
  1. Bold and underlined letters represent sense sequences of pre-miRNAs derived from the 3D gene.