Skip to main content

Table 1 Primers used for PCR amplification.

From: Rice black-streaked dwarf virus P6 self-interacts to form punctate, viroplasm-like structures in the cytoplasm and recruits viroplasm-associated protein P9-1

Primer Sequence (5′→3′) a Locations b and modifications
PGFP-F ggtacc ATGGGTAAAGGAGAAGAAC 1aa;Kpn I
PGFP-R gagctc TTATTTGTATAGTTCATC full-length reverse primer with stop codon; Sac I
PS6-1-F CG ggatcc ATGTCTGCCC 1aa; Bam HI
PS6-4-F CTAG ccatgg GA ATGTCTGCCCACCTGACCAATTTAG 1aa; Nco I
PS6-5-R CG ggatcc TTACTCAGAGCTTAGTTGCCAGAGG full-length reverse primer with stop codon; Bam HI
PS6-6-R CCG ctcgag CTCAGAGCTTAGTTGCC full-length reverse primer without stop codon; Xho I
PS6-8-R CCG ctcgag ATCAGCTACTTCGTCAG 449aa; Xho I
PS6-9-F CG ggatcc AC ATGTCTGCCCACCTG 1aa; Bam HI
PS6-10-F CCG ctcgag ccatgg AAGCTTCTGATGTCCAG 274aa; Xho I, Nco I
PS6-11-F CCG ctcgag ccatgg ACTTGATTAATCATGCC 395aa; Xho I, Nco I
PS6-12-R CG ggatcc ggtacc ATCTCCAAAGTTAGCATCTAC 703aa; Bam HI, Kpn I
PS6-15-R CG ggatcc ggtacc CGTTTCATTAGCAGATGTTTTG 659aa; Bam HI, Kpn I
PS6-16-R TCC cccggg GAACAGATCGGCATGATTAATC 403aa; Sma I
PS6-17-F TCC cccggg GTGAATGATTTAACTGACGAAG 440aa; Sma I
PS6-18-R CATG gggccc GTCTTTCTCTTTTAGTAAAGAACAG 615aa; Apa I
PS6-19-F CATG gggccc TCTGCTAATGAAACGAATGATG 655aa; Apa I
PS6-20-R CATG gggccc GGCAATCTGTTCTTTAGCTTGTC 580aa; Apa I
PS6-21-F CATG gggccc GAGAACGAAATGTTGAAGGAACAG 620aa; Apa I
PS6-24-F GC tctaga ccatgg ACGTACTCAACCTGTCCAA 98aa; Xba I, Nco I
PS6-25-F GC tctaga ccatgg AAGCTTCTGATGTCCAGTC 274aa; Xba I, Nco I
PS6-26-R CCG ctcgag ggtacc CTCAGAGCTTAGTTGCCAGAG full-length reverse primer without stop codon; Xho I Kpn I
PS9-5-F CTAG ccatgg GA ATGGCAGACCAAGAGCG 1aa; Nco I
PS9-6-R CG ggatcc AACGTCCAATTTCAAGG full-length reverse primer without stop codon; Bam HI
PS9-9-F CG ggatcc ATGGCAGACC AAGAGCG 1aa; Bam HI
PS9-10-R CCG ctcgag AACGTCCAATTTCAAGG full-length reverse primer without stop codon; Xho I
PS9-11-F CCG gaattc TCTCATCTCCCTAACC 76aa; Eco RI
PS9-12-R CG ggatcc CAAATACATTAAAAAGCC 207aa; Bam HI
PS9-13-F CCG gaattc GGTGAAAATCCAAACTC 208aa; Eco RI
PS9-14-R CG ggatcc GTGATTAACTTCTTTATTTG 248aa; Bam HI
PS9-15-F CCG ctcgag CT ATGGCAGACCAAGAGCG 1aa; Xho I
PS9-16-R ggtacc ggatcc TCAAACGT CCAATTTCAAG full-length reverse primer, Kpn I, Bam HI
PS9-17-F gaattc gtcgac ATGGCAGACCAAGAGC 1aa, Eco RI, Sal I
PS9-18-F gaattc gtcgac ATGTCGTTGTTGCCAAT 167aa, Eco RI, Sal I
PS9-19-F gaattc gtcgac ATGTATATAAAAGGCTT 198aa, Eco RI, Sal I
  1. a Introduced restriction endonuclease sites are in lower case. Two extra nucleotides (italicized) were added to allow in-frame expression of fusion proteins of interest.
  2. b Numbered according to P6 amino acid sequence. The F or R designation in the primer names denotes whether the primer is a forward (5′) or reverse (3′) primer, respectively.