Skip to main content

Table 1 Sequence of siRNA oligonucleotides directed against structural genes of HCV 1a genotype

From: Inhibition of full length Hepatitis C Virus particles of 1a genotype through small interference RNA

SN siRNAs Name Sequence 5'-3'
1 Csi 29-antisense AAACCAAACGTAACACCAACCCCTGTCTC
2 Csi 29-sense AAGGTTGGTGTTACGTTTGGTCCTGTCTC
3 Csi 301-antisense AAGGTCATCGATACCCTTACGCCTGTCTC
4 Csi 301-sense AACGTAAGGGTATCGATGACCCCTGTCTC
5 E1si 52-antisense AACTCGAGTATTGTGTACGAGCCTGTCTC
6 E1si 52-sense AACTCGTACACAATACTCGAGCCTGTCTC
7 E1si 192-antisense AACGCAGCTTCGACGTCATATCCTGTCTC
8 E1si 192-sense AAATATGACGTCGAAGCTGCGCCTGTCTC
9 E2si 86-antisense AACTGATCAACACCAACGGCACCTGTCTC
10 E2si 86-sense AATGCCGTTGGTGTTGATCAGCCTGTCTC
11 E2si 493-antisense AATTGGTTCGGTTGTACCTGGCCTGTCTC
12 E2si 493-sense AACCAGGTACAACCGAACCAACCTGTCTC