Skip to main content

Table 2 Sequences of oligonucleotides primers used for PCR amplification

From: Different linkages in the long and short regions of the genomes of duck enteritis virus Clone-03 and VAC Strains

Primer Sequences (5'-3') Positiona
L1 AGTCCAGTCATCTCCATCCG 1,562-1,581
L2 ACGATTTGGCTGTGCTGTAG 1,730-1,749
L3 CTGTCTTAAGGTTAGGGCTGGC 4,532-4,553
L4 GTAGGAAATATTGAGCCGAG 4,826-4,845
L5 TTCTGATGTTTTGGCAAGCC 7,578-7,597
L6 CAGAATGGCGCTTTGTTTGG 7,669-7,688
L7 TTGAAGATAGGTTGCTCGTAG 11,272-11,292
L8 ATACAGGAAAATTAACGAT 11,367-11,385
L9 ATGTAGCAGTTTGTTCAAAC 14,193-14,212
L10 AAGATGAGTCAACACCGAAGG 14,445-14,465
L11 TATTCCATCCAGTTGCTCCC 17,732-17,751
L12 CTTGTAAAGCTGGCCGCTAC 17,978-17,997
L13 CGATCTGCTTTCGCTTTCCG 21,725-21,744
L14 TAGCTGGTATGGCAACAATG 21,895-21,914
L15 GAAGTTAACGGAGGAAGTATT 26,043-26,063
L16 GCATATAATTACTACGCAACC 26,165-26,185
L17 GTCATCCTTGTTATGTTGA 29,697-29,715
L18 CCTACTTGGTGGTCGGCCA 29,795-29,813
L19 CAGGATTTGATAACTAACC 34,266-34,284
L20 ATAAGCGCACTAGATGGCAG 34,473-34,492
L21 TGAACGGACCTTTGCTAATGAC 37,793-37,813
L22 GAGGGGTGGTACTGGTTCCG 38,120-38,139
L23 CCTACAATAACCTGGGAACT 40,770-40,789
L24 GATCTTGTCCGATGGGGATG 40,949-40,968
L25 ATGGGACAGTCCCTACCGTTGGCCTCGATTCAAAGCTTCTCAG 1-43
L26 GGACTGCAGGCCTTTCAACGGCCCCTGATATGGCTACTATGTC 18,716-18,758rb
L27 GCCAGCCCTAACCTTAAGACAG 4,532-4,553r
L28 CAACCCCGCCCACAATAAGC 4,043-4,062
L29 GCTTACATGCTTTTCCCCGC 8,712-8,731r
L30 CGAACCGTCACAGTCTGCAG 8,592-8,611
L31 GCCGCGCAGTAAGTACTCAG 13,315-13,334
L32 TGCCGATATCATTGGTTCAT 13,212-13,231
N1 TATAGGTTT(C/A)TGTT NPc
N2 CTTTTGGAGCTG NP
N3 GAATGTGA(A/G)AA NP
N4 CATGTCTGCCGA NP
  1. a the position is according to the sequence of the whole fragment of 42,897 bp.
  2. b r indicates the reverse direction.
  3. c NP indicates no prediction.