Skip to main content

Table 2 Oligonucleotide primers used in RT-PCR amplification and nucleotide sequencing of 07V063

From: Characterization of a circulating PRRSV strain by means of random PCR cloning and full genome sequencing

Primer Sequence Position
5'endFW atgatgtgtagggtattccccc 1-22
Orf1univFW ccctttaaccatgtctggc 111-130
Orf1-1fw catcc gggtg ctgctgg ctt 336-355
Orf1-2fw ggag ccaccc acgtgtt gac 681-701
Lav49fw aatcaatggtattcgtgctg 1072-1091
Orf1-3-fw tcaat gcctacaa ctgcccg 1631-1650
Orf1-4-fw cttgta taaa ttgct attgg 1988-2007
Orf1-5-fw acaa cagg cctc gtaa ggg 2472-2490
Lav73fw aaaacttggcgctgcacgtc 3102-3121
Orf1-6fw ggtcc atta gcca gcgcct 3451-3469
Orf1-7fw cttgag cagcg ccaa cattg 3686-3705
Lav33fw ggtgttggcacggcgagag 4129-4147
Orf1-8fw catgg ctgtt gccca agtgt 4538-4557
Orf1-9fw ttgt gctt acgcc tggccca 4859-4878
Orf1-10fw ggcgac tcct ataat cgtat 5364-5383
Orf1-11fw ccaa gcac ttcg cagg tccg 5701-5720
Orf1-12fw ggctt ggctg ccgaaa tcgg 6096-6115
Orf1-13fw aatgaa gggag tctt gtcta 6566-6586
Lav92fw gtgtatccctcggctaccac 6891-6911
Orf1-14fw catta gtcaa cttcaa ggtt 7280-7299
Orf1-15fw gga ccc tga gcgg catgaa 7765-7783
Lav12fw ccaagaactccatggcaggt 8172-8191
Orf1-16fw ggaaaaacaaattcaaggag 8442-8461
Orf1-17fw tccag cccatg ctggt ata 8817-8835
Lav51fw gtgtttgtttcactcacact 9316-9335
Amp6fwint catcagaccatgtttgacat 9764-9783
Orf1-18fw aaggc caggaa cacca gggt 10136-10155
Orf1-19fw cccagta tttgca ccttt gc 10633-10652
Orf1-20fw cggccgta cttgc aaccag 11132-11150
Orf2afw gts aca cck tat gatta cg 11387-11406
LavORF2aseqfw gtgttcgacaacgcccacacgc 11577-11598
Orf3fw agcc taca gta caa ca ccac 12234-12253
LavORF3seq1fw agcgttgagctcatcttccc 12261-12280
Orf4fw cgg ccc ait tcc atccigag 12672-12691
Orf5Pesfw tga tca cat tcg gtt gct 13320-13337
Orf6fw tacc aa ctt tc ttc tggac 13838-13856
Orf7fw tgg cccc tgccc aic acg 14328-14345
Orf1-1-rev gtcaa cacgt gggtgg ctcc 701-681
Lavgsprev cgacttgacattctagtcca 900-881
Orf1-2-rev agat gcca aacgg acgaa cc 1304-1285
Orf1-3-rev gcag cctt cgga gcag acgc 1796-1777
ORF1-4-rev cggtg aaca cgag acacc tg 2252-2233
Orf1-5-rev gctg atgt tgtc ggatt ctg 2615-2596
Orf1-6-rev ctggg aaca ggagg cgg tgt 3202-3182
Orf1-7-rev gggttgg atg gagtc gagaa 3730-3711
Lav33rev ccccaacacttgtgacaacg 3982-3963
Orf1-8rev gt ccgag tccac tacaatc 4403-4385
Orf1-9rev agag ttgt gccac tgct gaaa 4755-4735
Amp3intrev2 cagagaaggccggttattcct 5023-5003
Amp3intrev gattccaatgagatcacca 5609-5591
Orf1-10rev gctc ggac taaaa cagc tgg 5959-5940
Lav92rev caccaatgatgatgataggg 6222-6203
Orf1-11rev cttg caca gaca cagtttt 6720-6702
Orf1-12rev ttcaa ggca gttg tca ggct 7190-7171
Orf1-13rev tca ttaa gacg acacc ggaa 7406-7386
Orf1-14rev cttg ccat cgga cacaa gg 7903-7885
Orf1-15rev tga cacc actg agcg ccga 8396-8378
Orf1-16rev agaca cact ggtg acggggt 8696-8676
Lav51rev aagaaagctgggtttgtcag 8971-8952
Orf1-17rev cggaa tctg tttcaa cacag 9460-9441
Orf1-18rev ccagg tggtt gcaa tatcca 9944-9925
Orf1-19rev aaaactccc gaag ttggtcg 10385-10366
Orf1-20rev aggc ttgc tgtag tgggcat 10762-10743
Lav82rev ttcaagctggaagtaggc 11244-11225
Orf1-21rev tgatttt gctcc acag tgac 11741-11722
Orf2arev tcatr ccc tatt y tgc acca 12558-12539
Orf3rev agaa aa gg cacgc ag aaa gca 13184-13165
Orf4rev cattcagctcgcataicgtcaag 13569-13547
Orf5Pesrev ggg cgt ata tca tta tag gtg 14100-14079
Orf6rev acccagc aa ctgg cacag 14606-14589
Orf7rev tcg ccc taa ttg aa tagg tga 14966-14946