Skip to main content

Table 1 Primers used in this study.

From: Full genome comparison and characterization of avian H10 viruses with different pathogenicity in Mink (Mustela vison) reveals genetic and functional differences in the non-structural gene

Gene Primer name Primer sequence (5'-3')
PB2 PB2-F1 TATTGGTCTCAGGGAGCGAAAGCAGGTC
  PB2-R1 TCYTCYTGTGARAAYACCAT
  PB2-F2 TAYGARGARTTCACAATGGT
  PB2-R2 ATATGGTCTCGTATTAGTAGAAACAAGGTCCTTT
PB1 PB1-F1 TATTCGTCTCAGGGAGCGAAAGCAGGCA
  PB1-R1 TTRAACATGCCCATCATCAT
  PB1-F2 ARATACCNGCAGARATGCT
  PB1-R2 ATATCGTCTCGTATTAGTAGAAACAAGGCATTT
PA PA-F1 TATTCGTCTCAGGGAGCGAAAGCAGGTAC
  PA-R1 TNGTYCTRCAYTTGCTTATCAT
  PA-F2 CATTGAGGGCAAGCTTTC
  PA-R2 ATATCGTCTCGTATTAGTAGAAACAAGGTACTT
HA HA-F1 GCAAAGCAGGGGTCACAATGTCA
  HAR1 TCTGAATCAGCCATGTCAATTGT
  HA-F2 GATTTCCATTGGACGATGGTACAACCA
  HA-R2 GGGTGTTTTTAACTAAATACAGATTGTGC
NP NP-1F AGCRAAAGCAGGGTDKATA
  NP-1R CYARTTGACTYTTRTGTGCTGG
  NP-2F TAYGACTTTGARAGAGAAGG
  NP-2R AGTAGAAACAAGGGTATTTT
NA N4-F AGCAAAAGCAGGAGTTTCATAATGA
  N4-R CATGGCCCGATGGCGCTCTGTTG
  N7-F GTGATCGAGAATGAATCCAAATCAGA
  N7-R GCATTTTACGAAAAGTATTGGATTTG
M M-F AGCRAAAGCAGKTAG
  M-R AGTAGAAACAAGGTARKTTTT
NS NS-F CAAAAACATAATGGATYCCAACACK
  NS-R ATTAAATAAGCTGAAAMGAGA A