Skip to main content

Table 1 Oligonucleotide primers used for nPCR amplification of WUPyV, KIPyV, MCPyV and simian polyomavirus LPyV

From: Newly described human polyomaviruses Merkel Cell, KI and WU are present in urban sewage and may represent potential environmental contaminants

Primer Virus region Position Amplification reaction Product size (bp) Annealing temperature (°C) Sequence (5'-3')
WU1 WUPyV (VP1)a 1730-1750 First 505 55 CCCACAAGAGTGCAAAGCCTTC
WU2   2234-2213     AGGCACAGTACCATTGGTTTTA
WU3   2044-2063 Nested 164 50 AGTTTTGGTGCTTCCTKTSC
WU4   2207-2188     TACAGTATACTGAGCAGGC
KI1 KIPyV (VP1)b 1684-1704 First 378 59 GCTGCTCAGGATGGGCGTGA
KI2   2061-2043     CAGKGTTCTAGGGTCTCCTGGT
KI3   1899-1918 Nested 190 54 GTTGCTTGTTGTACCTCTAG
KI4   2088-2067     AATTGTATAGGTAGTTGGGCCT
MC1 MCPyV (TAg)c 1716-1736 First 477 55 GCCTGTGAATTAGGATGTATTT
MC2   2210-2198     CATTTCTGTCCTGGTCATTTCCA
MC3   2010-2033 Nested 183 50 GCCCATTATCTAGACTTTGCAAA
MC4   2192-2173     TCTAACCTCCTTTTGGCTA
MC1b MCPyV (VP1)c 3174-3194 First 440 58 GGCTTTCTTTTTGAGAGGCCT
MC2b   3613-3592     AGTGGGCCCTCTATGCAAAGGA
MC3b   3276-3297 Nested 240 54 TTGGGTAAACAGTTTTCTCCTG
MC4b   3515-3493     TGCCTAGATATTTTAATGTTACT
MC1c MCPyV (VP1/2/3)c 4228-4252 First 265 53 GAATTAACTCCCATTCTTGGATTCA
MC2c   4492-4472     TTGGCTTCTTCCTCTGGTACT
MC3c   4264-4286 Nested 198 53 ATTTGGGTAATGCTATCTTCTCC
MC4c   4461-4439     GGATATATTTCTCCTGAATTACA
LN1 LPyV(VP2/VP3)d 1542-1564 First 423 54 GGCACACCAAAGAGTAACTCAAG
LN2   1965-1943     CAGGTCATGTCTTCATTTAGGAG
LN3   1617-1639 Nested 232 54 GGAAGTGGAGCTTAATAAATTGG
LN4   1863-1849     ATATCCATACAAGTCCTCAGAAG
  1. VP1, VP2 and VP3 = Virion protein 1, 2 and 3; TAg = T antigen; K= G +T; S = G + C
  2. a The sequence positions are referred to strain EF444549
  3. b The sequence positions are referred to strain EF127906
  4. c The sequence positions are referred to strain EU375803
  5. d The sequence positions are referred to strain K02562