Skip to main content

Table 1 Oligonucleotides used for cloning and sequencing of the IHNV genome

From: Molecular characterization of the virulent infectious hematopoietic necrosis virus (IHNV) strain 220-90

IHNV primers Sequences Position
IHNV 1F GTATAAGAAAAGTAACTTGAC 1-21
IHNV 1R CTTCCCTCGTATTCATCCTC 2097-2078
IHNV 2F GCAGGATCCCAAGAGGTGAAG 2033-2053
IHNV 2R GGAACGAGAGGATTTCTGATCC 3819-3818
IHNV 3F CAGTGGATACGGACAGATCTC 3767-3787
IHNV 3R CTTGGGAGCTCTCCTGACTTG 5579-5559
IHNV 4F GTACTTCACAGATCGAGGATCG 5523-5544
IHNV 4R CGGGGACTCTTGTTCTGGAATG 7147-7128
IHNV 5F CGTACCAGTGGAAATACATCGG 7098-7119
IHNV 5R CAGGTGGTGAAGTAGGTGTAG 9018-8997
IHNV 6F GAGGGAGTTCTTTGATATTCCC 8931-8952
IHNV 6R ATAAAAAAAGTAACAGAAGGGTTCTC 11130-11105
IHNV NheR CGTTTCTGCTAGCTTGTTGTTGG 525-503
IHNV 1MF ACAGAAGCTAACCAAGGCTAT 729-749
IHNV 2MF AGATCCCAATGCAGACCTACT 2610-2630
IHNV 3MF GTATCAGGGATCTCCATCAG 4322-4341
IHNV 4MF GATACATAAACGCATACCACA 6113-6133
IHNV 5MF TCAGAGATGAAGCTCAGCAA 7546-7565
IHNV 6MF AACACCATGCAGACCATACTC 9559-9579
IHNV 5'End CGATATTGAAGAGAAAGGAATAAC 10692-10715
Oligo (dT) GCGGCCGCTTTTTTTTTTTTTTTTTTTTT