Skip to main content

Table 3 Oligonucleotide sequences of primers and probes used in AHV-1 FQ-PCR detection

From: Development of TaqMan® MGB fluorescent real-time PCR assay for the detection of anatid herpesvirus 1

Name Type Sequences (5'to 3') Length (nt) Position Amplicon size (bp)
Real-Fa Forward ttttcctcctcctcgctgagt 21 357–377 60
Real-Pa Probe ccctgggtacaagcgc 16 383–398  
Real-Ra Reverse ggccgggtttgcagaagt 18 399–416  
Con-Fb Forward ggacagcgtaccacagataa 20 246–265 498
Con-Rb Reverse acaaatcccaagcgtag 17 727–743  
IC-Fc Forward acgagcgcaacccttga 17 1054–1070 92
IC-Pc Probe cggtttgtcaccggcagtcacct 23 1103–1125  
IC-Rc Reverse acgtcatccccaccttact 19 1127–1145  
  1. a Based on the nucleotide sequence AF064639.
  2. b Based on the nucleotide sequence AF064639.
  3. c Based on the nucleotide sequence AJ971894.