From: Development of TaqMan® MGB fluorescent real-time PCR assay for the detection of anatid herpesvirus 1
Name | Type | Sequences (5'to 3') | Length (nt) | Position | Amplicon size (bp) |
---|---|---|---|---|---|
Real-Fa | Forward | ttttcctcctcctcgctgagt | 21 | 357–377 | 60 |
Real-Pa | Probe | ccctgggtacaagcgc | 16 | 383–398 | |
Real-Ra | Reverse | ggccgggtttgcagaagt | 18 | 399–416 | |
Con-Fb | Forward | ggacagcgtaccacagataa | 20 | 246–265 | 498 |
Con-Rb | Reverse | acaaatcccaagcgtag | 17 | 727–743 | |
IC-Fc | Forward | acgagcgcaacccttga | 17 | 1054–1070 | 92 |
IC-Pc | Probe | cggtttgtcaccggcagtcacct | 23 | 1103–1125 | |
IC-Rc | Reverse | acgtcatccccaccttact | 19 | 1127–1145 |