Skip to main content

Table 1 Oligonucleotides used in this study (restriction sites are in bold)

From: A novel adenovirus vector for easy cloning in the E3 region downstream of the CMV promoter

Oligonucleotides used for: 5'-3' sequences length of amplified fragments (bp)
Amplification of E3 flanking regions CGCGACGCGT TTCGACAGGGCTAC  
  CGCGACGCGT GTTTCAGGCGCAGTTG 2731
  CCCTAGATCTAGA AATGGACG  
  GCGTCTAGA TCCAATATTCTGGGTCC 2013
Insertion of TCS in adenovirus genome GATAACAGATTTAAAT CCTTCGAA CAGAATCGAT  
  GGCCATCGAT TCTGTTCGAA GGATTTAAAT CTGTT  
PCR to check pAd5CMV/TCS CGTGTCATATGGATACACGGG  
  TCCAGCATGGCTACAACCTC 2643
EGFP amplification from pEGFPC3 AGGAAAAAAATTTAAAT CCACCATGGTGAGCAAGGGCGAGGAGCT  
  AGGAAAAAAATCGAT CGCGTTAAGATACATTGAGTTTGGAC 1034
PCR to check pAd5CMV-EGFP GGCACCAAAATCAACGGGAC  
  AGGAAAAAAATCGATCGCGTTAAGATTACATTGAGTTTGGAC 2312
Amplification of TK from pMBP-TK AGGAAAAAAATTTAAAT GCGCGTATGGCTTCGTAC  
  AGGAAAAAAATTTAAAT GAGTTAGCCTCCCCCATC 1129
  AGGAAAAAATTCGAA TCAGTTAGCCTCCCCCATC 1129