Skip to main content

Table 1 Primers for real-time PCR.

From: Herpes Simplex Virus Type 1 Us3 Gene Deletion Influences Toll-like Receptor Responses in Cultured Monocytic Cells

Primer   Sequence
(5'> 3')
TLR2 Forward CAGGGCTCACAGAAGCTGTAA
  Reverse GCCCAGGGAAGAAAAAGAATC
TLR3 Forward TAGCAGTCATCCAACAGAATCAT
  Reverse AATCTTCTGAGTTGATTATGGGTAA
TLR4 Forward ACACAGAAGAGCTGGCATGA
  Reverse GGTTGTCGGGGATTTTGTAG
TLR9 Forward CTTCCCTGTAGCTGCTGTCC
  Reverse CCTGCACCAGGAGAGACAG
IFN-α(1/13) Forward TGGCTGTGAAGAAATACTTCCG
  Reverse TGTTTTCATGTTGGACCAGATG
IFN-β Forward TCTCCACGACAGCTCTTTCCA
  Reverse ACACTGACAATTGCTGCTTCTTTG
MyD88 Forward TGGCACCTGTGTCTGGTCTA
  Reverse ACATTCCTTGCTCTGCAGGT
IRF-3 Forward GTTCTGTGTGGGGGAGTCAT
  Reverse CTGTTGGAAATGTGCAGGTC
TRIF Forward CCTCCTCCTCCTCCTTCATC
  Reverse GCGTGGAGGATCACAAAGTT