Skip to main content

Table 1 Oligonucleotides used for construction of the antisense plasmid and for real-time PCR

From: Antisense RNA directed to the human papillomavirus type 16 E7 mRNA from herpes simplex virus type 1 derived vectors is expressed in CaSki cells and downregulates E7 mRNA

Purpose Name Sequence (5'-3')
pRB5225 E7ASp-FP GCTTAGGGTACCATGCATGGAT GATACACCTA
construction E7ASp-RP GCTTAGGGTACCCTCTGAGCTGTCATTTAA
Real-time HBVAS-FP GAGAAGGGTCGTCCGCAGGAT
PCR 16E7AS-RP CTCTGAGCTGTCATTTAATTGCTCATA
anti-E7 16E7AS-PRO (6-FAM)-TGAATATATGTTAGATTTGCAACCAGAGACAACTGATCTCTACT-(TAMRA)
Real-time 16E7-FP CAGCTCAGAGGAGGAGGATGAA
PCR 16E7-RP CACACTTGCAACAAAAGGTTACAATATT
HPV-16 E7 16E7-PRO (6-FAM)-CCAGCTGGACAAGCAGAACCGGAC-(TAMRA)
  1. Abbreviations: AS, antisense; p, plasmid; FP, forward primer, RP, reverse primer; PRO, probe; FAM, 6-carboxyfluorescein; TAMRA, 6-carboxy-tetramethylrhodamine. The underlined base (T) in the primer "E7ASp-FP" is an insertion that introduces a frameshift and two stop codons in the sense orientation of the HPV-16 E7 ORF. The presence of the frameshift mutation in the pRB5225 plasmid was verified by sequencing. The primers and probes for the real-time RT-PCR except for "HBVAS-FP" were designed using Primer Express software (Applied Biosystems).