Skip to main content

Table 1 List of the oligonucleotide primers used in this study for amplification of cassava mosaic geminiviruses from Tanzania (anfl = near-full length, ps = partial sequence)

From: Molecular biodiversity of cassava begomoviruses in Tanzania: evolution of cassava geminiviruses in Africa and evidence for East Africa being a center of diversity of cassava geminiviruses

Primer name Nucleotide sequence (5'→3') Begomovirus isolate DNA component
UGT-F TCGTCTAGAACAATACTGATCGGTCTCC EACMV-KE-[TZT] DNA-A fla
UGT-R CGGTCTAGAAGGTGATAGCCGAACCGGGA EACMV-KE-[TZT] DNA-A fl
3T-F ACGTCTAGAACAATACTGATCGGTCTC EACMV-TZ-[YV] DNA-A fl
3T-R GTGCTCTAGAAGGTGATAGCCGAACCGGGA EACMV-TZ-[YV] DNA-A fl
TZ1B-F GCGCGGAATCACTTGTGAAGCAGTCGT EACMCV-[TZ1] DNA-B fl
TZ1B-R GCCGGGATTCGGTGAGTGGTTTACATCAC EACMCV-[TZ1] DNA-B fl
EAB555/F TACATCGGCCTTTGAGTCGCATGG CMGs BC1/CR
EAB555/R CTTATTAACGCCTATATAAACACC CMGs BC1/CR
UNI/F KSGGGTCGACGTCATCAATGACGTTRTAC CMGs DNA-A nfl
UNI/R AARGAATTCATKGGGGCCCARARRGACTGGC CMGs DNA-A nfl
AT-F GTGACGAAGATTGCATTCT ACMV-[TZ] DNA-A ps
AT-R AATAGTATTGTCATAGAAG ACMV-[TZ] DNA-A ps
ATZ1-F TAAGAAGATGGTGGGAATCC EACMCV-[TZ1] DNA-A ps
ATZ-R CGATCAGTATTGTTCTGGAAC EACMCV-[TZ1] DNA-A ps
TZ7-F TGGTGGGAATCCCACCTT EACMCV-[TZ7] DNA-A ps
TZ7-R GTATTGTTATGGAAGGTGATA EACMCV-[TZ7] DNA-A ps
TZM-F TATATGATGATGTTGGTC EACMV-UG2Svr-[TZ10] DNA-A ps
TZ10-R TAGAAGGTGATAGCCGTA EACMV-UG2Svr-[TZ10] DNA-A ps
TZM-F TATATGATGATGTTGGTC EACMV-KE-[TZM] DNA-A ps
TZM-R TAGAAGGTGATAGCCGAAC EACMV-KE-TZM] DNA-A ps