Skip to main content

Table 5 CODEHOP and gene-specific primers developed for cloning the divergent region B within the RFHV genome

From: CODEHOP-mediated PCR – A powerful technique for the identification and characterization of viral genomes

Primer Gene Target Bias2 Sense 5'>3' Sequence (degenerate codons are in lower case)3
   3' Core 5' Clamp   
CODEHOP 1      
RHFGA (48) TS4gene All cellular and viral TS KSHV5 + CCTGTTTACGGTTTCcartggagrcayttygg
DMGLB (32) TS gene All cellular and viral TS KSHV - GGCAATGTTAAAAGGAACTccnarncccatrtc
RFHVMn-specific 6      
PolF1LR DNA polymerase NA7 NA + CCACCGTCCCAGACCAACGAAAGCGCCAGA
TSR1LR TS gene NA NA + GTCTGCCTGGAATCCCGTGGATATACCAAA
  1. 1 CODEHOP, consensus-degenerate hybrid oligonucleotide primers. The degree of degeneracy, ie the number of individual primers in the pool, is given in parentheses.
  2. 2 Bias indicates the reliance on a specified subset of sequences for determination of the 3' degenerate core or 5' consensus clamp.
  3. 3 See legend to Table 1 for the IUB code.
  4. 4 TS, thymidylate synthase.
  5. 5 Clamp region derived from the KSHV viral TS gene [11]
  6. 6 Primer sequence derived from the RFHVMn sequence obtained by the CODEHOP technique
  7. 7 NA, not applicable – these are gene-specific primer