Skip to main content

Table 1 Primer and PCRs used in this study

From: Molecular characterisation of human hepatitis E virus from Italy: comparative analysis of five reverse transcription-PCR assays

Method Target region Primer ID Sequence (5′–3′) Product length (bp) Primer position (5′–3′)*
Method A ORF1 1679 CCAYCAGTTYATHAAGGCTCC 348 36-56
  1680 TACCAVCGCTGRACRTC   383-367
  1681 CTCCTGGCRTYACWACTGC 172 53-71
  1682 GGRTGRTTCCAIARVACYTC   224-205
Method B ORF1 1829 ACATTTGAATTATCTGACATTGTGCA 1076 3880-3905
  1828 ACACACATCTGAGCTACATTCGTGAG   4955-4930
  1830 GACGTGTCCAGGATCACCTTCTTC 559 4147-4170
  1831 ACTCACTGCAAAGCACTATCGAAT   4705-4682
Method C ORF2 1722 CAAGGHTGGCGYTCKGTTGAGAC 506 5912-5934
  1723 CCCTTRTCCTGCTGAGCRTTCTC   6417-6395
  1724 GYTCKGTTGAGACCWCBGGBGT 457 5922-5943
  1725 TTMACWGTCRGCTCGCCATTGGC   6378-6356
Method D ORF2 1837 AATTATGCYCAGTAYCGRGTTG 731 5687-5708
  1838 CCCTTRTCYTGCTGMGCATTCTC   6417-6395
  1839 GTWATGCTYTGCATWCATGGCT 348 5972-5993
  1840 AGCCGACGAAATCAATTCTGTC   6319-6298
Method E ORF2/ORF3 1847 GCRGTGGTTTCTGGGGTGAC 164 5259-5278
  1848 CTGGGMYTGGTCDCGCCAAG   5422-5403
  1849 GYTGATTCTCAGCCCTTCGC 137 5282-5301
  1850 GMYTGGTCDCGCCAAGHGGA   5418-5399
  1. *Primer positions are based on GenBank sequence accession no. M73218.