Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 4 Nucleotide sequences of the designed primers

From: Occurrence of genetic modifications in core, 5′UTR and NS5b of HCV associated with viral response to treatment

PCR Genomic region Sequence of primers
Nested 5′UTR SP1: 5′CTGTGAGGAACTACTGTCTT 3′
ASPI : 5′ATACTCGAGGTGCACGGTCTACGAGACCT 3′
SP2: 5′TTCACGCAGAAAGCGTCTAG 3′
ASP2: 5′CACTCTCGAGCACCCTATCAGGCAGT 3′
Nested Core SP1: 5′ ACTGCCTGATAGGGTGCTTGC 3′
ASP1: 5′ ATGTACCCCATGAGGTCGGC 3′
SP2: 5′ AGGTCTCGTAGACCGTGCAC 3′
ASP2: 5′ CACGTAAGGGTATCGATGAC 3′
Semi nested NS5B SP1: 5′ GCCTTCACGGAGGCTATGAC 3′
ASP1: 5′ GGCACCCAAGCTTTCTGAG 3′
ASP2: 5′ ACACGCTGTGATAAATGTC 3′