Identification and validation of a novel microRNA-like molecule derived from a cytoplasmic RNA virus antigenome by bioinformatics and experimental approaches

Table 1 Information of the predicted HAV antigenome-encoded miRNAs

HAV miRNA^a	miRNA sequence (5'-3')	Length (nt)	3p /5p	Position^b(nt)	Prediction tool^c
MR50-1	UACAUUCAUUGAACACUGAGUA	22	3p	5912 to 5933	MatureBayes
MR50-2	UAAAAAGCGUUUUGGAGACUAC	22	5p	5931 to 5952	MatureBayes
MR50-3	GAUGAUGAAUGGGACUCUUUC	21	5p	5953 to 5973	Bayes-SVM-MiRNA web server.
MR35-1	GAACUCUUGCUAUGCAGUCUCU	22	3p	4272 to 4293	MatureBayes
MR35-2	UGAUUUAUAGAUCCAAGGUUUU	22	5p	4306 to 4327	MatureBayes
MR35-3	CUAUGCAGUCUCUCAAAGGUG	21	3p	4264 to 4284	Bayes-SVM-MiRNA web server.

^aThe miRNAs (miR) derived from a single miRNA stem-loop precursor are indicated by a 5p (5' arm) or a 3p (3' arm) suffix.
^bGenomic positions are provided based on the published HAV genome sequence (GenBank accession no. EF406358.1).
^cPrediction strategy of each mature miRNA sequence is shown in table.

ISSN: 1743-422X