Skip to main content

Table 1 Information of the predicted HAV antigenome-encoded miRNAs

From: Identification and validation of a novel microRNA-like molecule derived from a cytoplasmic RNA virus antigenome by bioinformatics and experimental approaches

HAV miRNAa miRNA sequence (5'-3') Length (nt) 3p /5p Positionb(nt) Prediction toolc
MR50-1 UACAUUCAUUGAACACUGAGUA 22 3p 5912 to 5933 MatureBayes
MR50-2 UAAAAAGCGUUUUGGAGACUAC 22 5p 5931 to 5952 MatureBayes
MR50-3 GAUGAUGAAUGGGACUCUUUC 21 5p 5953 to 5973 Bayes-SVM-MiRNA web server.
MR35-1 GAACUCUUGCUAUGCAGUCUCU 22 3p 4272 to 4293 MatureBayes
MR35-2 UGAUUUAUAGAUCCAAGGUUUU 22 5p 4306 to 4327 MatureBayes
MR35-3 CUAUGCAGUCUCUCAAAGGUG 21 3p 4264 to 4284 Bayes-SVM-MiRNA web server.
  1. aThe miRNAs (miR) derived from a single miRNA stem-loop precursor are indicated by a 5p (5' arm) or a 3p (3' arm) suffix.
  2. bGenomic positions are provided based on the published HAV genome sequence (GenBank accession no. EF406358.1).
  3. cPrediction strategy of each mature miRNA sequence is shown in table.