Skip to main content

Table 1 Information of the predicted HAV antigenome-encoded miRNAs

From: Identification and validation of a novel microRNA-like molecule derived from a cytoplasmic RNA virus antigenome by bioinformatics and experimental approaches

HAV miRNAa miRNA sequence (5'-3') Length (nt) 3p /5p Positionb(nt) Prediction toolc
MR50-1 UACAUUCAUUGAACACUGAGUA 22 3p 5912 to 5933 MatureBayes
MR50-2 UAAAAAGCGUUUUGGAGACUAC 22 5p 5931 to 5952 MatureBayes
MR50-3 GAUGAUGAAUGGGACUCUUUC 21 5p 5953 to 5973 Bayes-SVM-MiRNA web server.
MR35-1 GAACUCUUGCUAUGCAGUCUCU 22 3p 4272 to 4293 MatureBayes
MR35-2 UGAUUUAUAGAUCCAAGGUUUU 22 5p 4306 to 4327 MatureBayes
MR35-3 CUAUGCAGUCUCUCAAAGGUG 21 3p 4264 to 4284 Bayes-SVM-MiRNA web server.
  1. aThe miRNAs (miR) derived from a single miRNA stem-loop precursor are indicated by a 5p (5' arm) or a 3p (3' arm) suffix.
  2. bGenomic positions are provided based on the published HAV genome sequence (GenBank accession no. EF406358.1).
  3. cPrediction strategy of each mature miRNA sequence is shown in table.
Back to article page

Virology Journal

ISSN: 1743-422X