Skip to main content

Table 1 List of primers used in both the 1 st and 2 nd rounds of PCR in this study

From: Detection of novel viruses in porcine fecal samples from China

Virus Targeted contig/read Targeted region Primer name PCR round Primer sequence Size (bp)
Astrovirus Contig 15 Astroviruses ORF1a region Set A-F 1st 5′- STTRCCWTGGSTYTGGGAGAT −3′ 402
Set A-R 5′- ATMAGCCTCCAGCAGAAGCA −3′
Contig 3 2ndA-F 2nd 5′- ACTGCYTCTACYTWGCAGCAG −3′ 199
2ndA-R 5′- ACATCWGCCARGAACATACC −3′
Contig 14 Astroviruses ORF1a region Set B-F 1st 5′- AGGCTAAACCTCAAGTTAG −3′ 360
Set B-R 5′- CCTACAGGAAAAGTTACTC −3′
2ndB-F 2nd 5′- CACGGATCTCAATGACATGACC −3′ 316
2ndB-R 5′- GCTATTGCACCTATTCAGAC −3′
Bocavirus Contig 5 Bocaviruses NS1 region Set C-F 1st 5′- TCTGCCTSAGGTSRGTGAGAA −3′ 224
Set C-R 5′- KATGCATCTCGAGMAYCTCKT −3′
Contig 18 2ndC-F 2nd 5′- GAGAAYTCKCTGGCTAGACAGA −3′ 185
2ndC-R 5′- AYCTCKTCKAGCGTYCGAGA −3′
Contig 19 Bocaviruses NS1 region Set D-F 1st 5′- TCTCTAGCTAGCGAGTTCTC −3′ 206
Set D-R 5′- TAGATGAGGTGCTCGAGATGCA −3′
2ndD-F 2nd 5′- ACCTCATCTAGCGTTCGAGA −3′ 159
2ndD-R 5′- GCCTGCTAAGATCACCAAA −3′
LV-like virus Read 12 LV-like virus 2C region Set E-F 1st 5′- CTCTTCTGCTATGGAACTGCT −3′ 452
Set E-R 5′- TTGCCGAAGTATCAGGCTTC −3′
2ndE-R 2nd 5′- CTGCTTGGCAATGATGTGTCGA −3′ 404
2ndE-F 5′- ACAAACGTGTGCAGTTTCTGG −3′