Skip to main content

Advertisement

Table 2 Oligonucleotide primers used for RT-LAMP assay and semi-nested RT-PCR against Akabane virus

From: Rapid detection of Akabane virus by a novel reverse transcription loop-mediated isothermal amplification assay (RT-LAMP)

Primers Sequence (5'-3') Nucleotide positions* Length (bp)
F3 TGTTCCACAACGGAATGC 27–44 18
B3 TGTAAATTTGACCCCTGCA 198–216 19
FIP GAGCTGCTGCCCATACTTACT-AGCTACATTTAATCCGGATGC   42
BIP TACTGTTGCTAGAGTCTTCTTCCTC-AGTAAGATCGACACTTGGTT   45
N1 ATGTTCCACAACGGAATGCAGC 25–46 22
N2 AGCCAGGAAAGCTCTAGCTGCAG 680–658 23
N3 GGAAAATGGTTATTAACCACT 215–235 21
  1. *Nucleotide sequence position according to nucleoprotein (N) gene of Akabane virus strain 93FMX (GenBank accession number FJ498797).