Skip to main content

Table 1 Primers for nucleic acid amplification assays

From: Genomic analysis of a newly isolated of Japanese encephalitis virus strain, CQ11-66, from a pediatric patient in China

Name 5 -3 Length
PrimerF1 AGTATCGTTGAGAAGAATCG 20
PrimerF2 TATGCTTTCCTGGCGGCGGTAC 22
PrimerF3 GAAGGGGAGACAAGCAGATCAA 22
PrimerF4 CTGCAAGAGAGGAAAAAGACCA 22
PrimerF5 GGAGGGGCAGAGTAGGCAGAAA 22
PrimerF6 CCGTTGGCTCGTGGAGAAAGGA 22
PrimerF7 TCAGCGGAGATGACTGTGTCGT 22
PrimerR1 CCTTCATTTCCTCCTCTTTTGT 22
PrimerR2 TGAACGGCTTTTCCTATGGAGT 22
PrimerR3 CAAACATCAATCCAACTGCCGA 22
PrimerR4 AGTCCATTGGGCATGTGTATGT 22
PrimerR5 TCTGCATGAGCATCGGTTCTTC 22
PrimerR6 AAATGGTTAGAGCAGAAGGGAA 22
PrimerR7 TCTTCCTCACCACCAGCTACAT 22