Open Access

Interleukin-2 enhancer binding factor 2 interacts with the nsp9 or nsp2 of porcine reproductive and respiratory syndrome virus and exerts negatively regulatory effect on the viral replication

Virology Journal201714:125

DOI: 10.1186/s12985-017-0794-5

Received: 5 April 2017

Accepted: 3 July 2017

Published: 11 July 2017

Abstract

Background

Porcine reproductive and respiratory syndrome virus (PRRSV) causes reproductive failures in sows and respiratory diseases in growing pigs, resulting in huge economic loss for the pig production worldwide. The nonstructural protein 9 (nsp9) and nonstructural protein 2 (nsp2) of PRRSV are known to play important roles in viral replication. Cellular interleukin-2 enhancer binding factor 2 (ILF2) participates in many cellular pathways and involves in life cycle of some viruses. In the present study, we analyzed the interaction of cellular ILF2 with the nsp9 and nsp2 of PRRSV in vitro and explored the effect of ILF2 on viral replication.

Methods

The interaction of ILF2 with the nsp9 or nsp2 of PRRSV was analyzed in 293FT cells and MARC-145 cells by co-immunoprecipitation (Co-IP) and the co-localization of ILF2 with the nsp9 or nsp2 of PRRSV in MARC-145 cell and pulmonary alveolar macrophages (PAMs) was examined by confocal immunofluorescence assay. The effect of ILF2 knockdown and over-expression on PRRSV replication was explored in MARC-145 cells by small interfering RNA (siRNA) and lentivirus transduction, respectively.

Results

The interaction of ILF2 with nsp9 or nsp2 was first demonstrated in 293FT cells co-transfected with ILF2-expressing plasmid and nsp9-expressing plasmid or nsp2-expressing plasmid. The interaction of endogenous ILF2 with the nsp9 or nsp2 of PRRSV was further confirmed in MARC-145 cells transduced with GFP-nsp9-expressing lentiviruses or infected with PRRSV JXwn06. The RdRp domain of nsp9 was shown to be responsible for its interaction with ILF2, while three truncated nsp2 were shown to interact with ILF2. Moreover, we observed that ILF2 partly translocated from the nucleus to the cytoplasm and co-localized with nsp9 and nsp2 in PRRSV-infected MARC-145 cells and PAMs. Finally, our analysis indicated that knockdown of ILF2 favored the replication of PRRSV, while over-expression of ILF2 impaired the viral replication in MARC-145 cells.

Conclusion

Our findings are the first to confirm that the porcine ILF2 interacts with the nsp9 and nsp2 of PRRSV in vitro, and exerts negatively regulatory effect on the replication of PRRSV. Our present study provides more evidence for understanding the roles of the interactions between cellular proteins and viral proteins in the replication of PRRSV.

Keywords

Porcine reproductive and respiratory syndrome virus (PRRSV) Nonstructural protein 9 (nsp9) Nonstructural protein 2 (nsp2) Interleukin-2 enhancer binding factor 2 (ILF2) Interaction Replication

Background

Porcine reproductive and respiratory syndrome virus (PRRSV) causes reproductive failures in sows and respiratory diseases in growing pigs, resulting in huge economic loss for the pig production worldwide [13]. The PRRSV is an enveloped, single-stranded positive sense RNA virus, which is classified into the order Nidovirales, family Arteriviridae, genus Arterivirus [4, 5]. The genome of this virus is approximately 15 kb in size and contains at least 12 overlapping open reading frames (ORFs), including ORF1a, ORF1b, ORF2a, ORF2b, ORFs 3 to 7 and ORF5a [612].

The ORF1a and ORF1b encode 4 known replicase polyproteins (pp1a, pp1a-nsp2N, pp1a-nsp2TF, and pp1ab) [13], and the replicase polyproteins are postranslationally processed into at least 16 distinct nonstructural proteins (nsp), mainly including nsp1α, nsp1β, nsps2 to 6, nsp7α, nsp7β, and nsps8 to 12 [7, 1417]. The remaining ORFs encode the structural proteins of PRRSV [9, 12, 1822]. Interestingly, the nsp2 is newly recognized to be an integral membrane protein of PRRSV as a structural protein [23, 24]. PRRSV strains worldwide can be classified into two genotypes, the European type (type 1) and the North American type (type 2) [25, 26]. The viruses of type 1 can be further divided into different subtypes, while type 2 can be differentiated into distinct genetic lineages due to the broad genetic variation and diversity of isolates [27].

The PRRSV nsps have been considered to be involved in viral replication and genome transcription [16], and in the modulation of host innate immune responses [2832]. Of the PRRSV nsps, the nsp9, the viral RNA-dependent RNA polymerase (RdRp), is considered to be a key enzyme for RNA-templated RNA synthesis [16]. It has been shown to play important roles in the replication efficiency, pathogenicity and virulence of the Chinese highly pathogenic PRRSV (HP-PRRSV) [33], and viral replication regulation via the interaction with cellular host proteins [3436]. Thus, it is essential to further explore the host cellular proteins interacting with the PRRSV nsp9 and analyze the biological significance of their interaction on the virus life cycle. Therefore, the immunoprecipitation (IP) combined with LC-MS/MS assay was performed to explore host cellular proteins interacting with nsp9. The nsp2, the largest nonstructural protein of PRRSV, is considered as a multifunctional protein in viral replication and pathogenesis [37, 38]. The nsp2, combined with the nsp3, comprises viral RNA synthesis site by inducing double membrane vesicle (DMV) formation [39]. Also, it potentially interacts with nsp1α, nsp1β, nsp3, nsp4, nsp7, nsp9, and nsp10 [40], which are all considered as important components of viral replication and transcription complex (RTC) for viral RNA synthesis [16, 41]. Given the important role of nsp2 in PRRSV replication, it is conductive to better understanding the viral replication process to identify interacting partner of nsp2.

The cellular protein_interleukin-2 enhancer binding factor 2 (ILF2), also named as nuclear factor 45 (NF45) in human and mouse, is initially defined as crucial transcription factors required for interleukin-2 expression during T-cell activation in mammals together with interleukin-2 enhancer binding factor 3 (ILF3), also known as nuclear factor 90 (NF90) in human and mouse [42]. Usually, ILF2 forms a heterodimeric complex with ILF3, which is shown to be implicated in DNA repair [43], gene transcription [44], microRNA processing [45, 46], and mRNA translation [47, 48]. Moreover, ILF2, ILF3 or the ILF2/ILF3 heterodimer has also been involved in various virus life cycle including hepatitis C virus (HCV) [49], infectious bursal disease virus (IBDV) [50], poliovirus [51], influenza virus [52, 53], dengue virus [54], human immunodeficiency virus type 1 (HIV-1) [55], human T-cell leukemia virus [56], as well as in the host defense mechanism protecting from viral infections [57]. Our previous study has screened that ILF3 interacts with the nsp2 of PRRSV JXwn06 [58]. Given that ILF2 usually forms a heterodimeric complex with ILF3 [42], it led us to propose ILF2 may also interact with nsp2. Thus, the aim of present study is to analyze the interaction of cellular ILF2 with the nsp9 and nsp2 of PRRSV in vitro and to explore the effect of their interactions on viral replication.

Methods

Cells, virus and antibodies

Both MARC-145 cells and human embryonic kidney 293FT cells were cultured in GIBCO Dulbecco’s modified Eagle medium DMEM (Fisher Scientific, Waltham, MA, USA) supplemented with 10% fetal bovine serum (FBS) in a humidified 5% CO2 atmosphere at 37 °C. Porcine pulmonary alveolar macrophages (PAMs) were prepared as previously described [59]. PAMs and 3D4/21 cells (ATCC CRL-2843), a PAM-derived cell line, were both maintained in RPIM-1640 (Fisher Scientific) containing 10% FBS. The stock of PRRSV strain JXwn06 with a titer of 107 TCID50/ml was used in this study [60]. Mouse anti-HA monoclonal antibody (mAb) (H3663), mouse anti-β-actin mAb (A5441), rabbit anti-Myc polyclonal antibody (C3956), rabbit anti-GFP polyclonal antibody (G1544) were all purchased from Sigma-Aldrich (St. Louis, MO, USA). Mouse anti-ILF2 mAb was purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Rabbit anti-ILF2 polyclonal antibody and rabbit anti-ILF3 polyclonal antibody were purchased from Proteintech Group (Chicago, IL, USA). The mAbs specific for the nsp9, nsp2 and N protein of PRRSV were prepared in our laboratory.

Plasmid construction

All plasmids were constructed by standard recombined DNA techniques. Briefly, the nsp9 gene of PRRSV JXwn06 was amplified by PCR from the plasmid pWSK-JXwn06 [60] and then cloned into the vector pWPXL (Addgene, Cambridge, MA, USA) to generate the recombinant plasmid pWPXL-nsp9. The pCMV-HA-nsp9, pCMV-Myc-nsp9 and the truncated nsp9-expressing plasmids were prepared in our laboratory [36]. The gene coding for ILF2 was amplified from PAMs and then inserted into the plasmids pCMV-HA (Clontech, Palo Alto, CA, USA), pCMV-Myc (Clontech) and pWPXL to generate pCMV-HA-ILF2, pCMV-Myc-ILF2 and pWPXL-ILF2, respectively. The nsp2 gene of PRRSV JXwn06 amplified by PCR from the plasmid pWSK-JXwn06 [60] was cloned into the vector pCMV-HA to construct the recombinant plasmid pCMV-HA-nsp2. Three fragments of nsp2 gene were respectively inserted into pWPXL to generate pWPXL-nsp2N (aa1-405), pWPXL-nsp2M (aa323-814) and pWPXL-nsp2C (aa323-1166). The primers used for plasmid construction were listed in Table 1. All recombinant plasmids were further verified by DNA sequencing.
Table 1

Primers used in this study

Primersa

Sequence (5-3′)b

Use

1F

AGCTTTGTTTAAACCCATGTACCCATACGATGTTC

pWPXL-nsp9 construction

1R

CGACGCGTAACTCATGATTGGACCTGAG

2F

ATGAGGGGGGACAGAGGCCGTG

ILF2 gene amplification

2R

TCACTCCTGAGTCTCCATG

3F

CCGGAATTCGGATGAGGGGGGACAGAG

pCMV-HA-ILF2/pCMV-Myc-ILF2 construction

3R

CGGGGTACCTCACTCCTGAGTCTCCATG

4F

AGCTTTGTTTAAACACCATGAGGGGGGACAGAG

pWPXL-ILF2 construction

4R

CGACGCGTAACTCCTGAGTCTCCATG

5F

CGCGTCGACGGCCGGAAAGAGAGCAAGGA

pCMV-HA-nsp2 construction

5R

GAAGATCTTCATCCCCCTGAAGGCTTCGAA

6F

AGCTTTGTTTAAACACCATGGCCGGAAAGAGAGCAAGG

pWPXL-nsp2N construction

6R

CGCGACGCGTAATGAAGTCGCCTGGGTGTTGGCTAG

7F

AGCTTTGTTTAAACACCATGGGCAAGGACTCGGTCCCTCTG

pWPXL-nsp2M construction

7R

CGCGACGCGTAATTGGTCTAAGAGCCTTCCTGC

8F

AGCTTTGTTTAAACACCATGGGCAAGGACTCGGTCCCTCTG

pWPXL-nsp2C construction

8R

CGCGACGCGTAATCCCCCTGAAGGCTTCGAAATTTGC

aF denotes forward PCR primer; R denotes reverse PCR primer

bRestriction sites are underlined

Lentivirus transduction

The lentivirus packaging system including three plasmids—pWPXL, pMD2.G and psPAX2 (Addgene) was employed. The amplified cDNA of nsp9 or ILF2 gene was cloned into pWPXL and expressed as a GFP-tagged protein. The recombinant lentiviruses that were expressing target protein were rescued according to the method previously described [61]. Briefly, 293FT cells were co-transfected with the three plasmids by using FuGENE HD Transfection Reagent (Promega, Madison, WI, USA) in Opti-MEM (Fisher Scientific). The supernatants were harvested when the cytopathic effect appeared, and were then filtered, concentrated and titrated. 3D4/21 cells or MARC-145 cells were transduced with the recombinant lentiviruses in the presence of polybrene (Sigma).

IP and Co-IP assays

To explore cellular proteins interacting with the nsp9 of PRRSV and further confirm the interactions, IP and Co-IP assays were performed, respectively. For IP assay, 3D4/21 cells were transduced with the recombinant lentiviruses that were expressing GFP-nsp9 or GFP. At 48 h post-transduction, the cells were harvested in IP buffer containing protease inhibitor cocktail (Sigma) and the supernatants were then collected by centrifugation at 12,000×g for 15 min. After being precleared with protein A/G Sepharose beads (GE Healthcare Bio-Science) for 2 h at 4 °C, the supernatants were precipitated with an anti-GFP mAb in conjunction with protein A/G Sepharose beads. The beads were then washed five times with IP buffer and subjected to boil for 5 min. The proteins isolated from the beads were separated by SDS-PAGE, followed by silver staining or western blotting. For the Co-IP assay of the exogenous ILF2 and nsp9 or nsp2, 293FT cells were transfected with ILF2-, nsp9- or nsp2-expressing plasmid individually or together. At 36 h post-transfection, the cells were harvested, centrifuged, precleared and precipitated with an anti-HA or anti-Myc mAb in conjunction with protein A/G Sepharose beads, followed by SDS-PAGE and western blotting. For the Co-IP assay of the endogenous ILF2 and nsp9 or nsp2, MARC-145 cells infected with the recombinant lentiviruses that were expressing nsp9 or with PRRSV JXwn06 were lysed at 48 h post-transduction or post-infection and then subjected to IP assay as mentioned above.

Silver staining

The proteins bound to the beads were separated by SDS-PAGE and then visualized using a Pierce™ Silver Stain kit (Fisher Scientific) according to the manufacturer’s instructions. The gels were washed with ultrapure water and fixed in ultrapure water containing 30% ethanol and 10% acetic acid. After being sensitized in Sensitizer Working Solution, the gels were stained with Stain Working Solution. Then, the protein bands were developed with Developer Working Solution and the reaction was stopped with 5% acetic acid in ultrapure water. All differential bands were manually excised from the stained gels and subjected to LC-MS/MS as previously described [59].

Western blotting

Protein samples were separated by SDS-PAGE, and were electrically transferred onto a polyvinylidenefluoride (PVDF) membrane. After being blocked with 5% skim milk in phosphate-buffered saline (PBS), the membrane was incubated with proper mAb or polyclonal antibody and subsequently probed with appropriate horseradish peroxidase (HRP)-conjugated goat anti-mouse or goat anti-rabbit secondary antibody. The protein bands were developed with the ECL western blotting system (Fisher Scientific) and exposed to a FluorChem E apparatus (ProteinSimple, Santa Clara, CA, USA).

Confocal immunofluorescence assay

MARC-145 cells and PAMs grown on coverslips in 24-well plates (Costar, Corning Incorporation) were infected with PRRSV JXwn06 at a multiplicity of infection (MOI) of 0.01. Uninfected cells served as mock control. At 36 h post-infection, the cells were fixed and permeabilized with cold anhydrous ethanol for 20 min at room temperature (RT), followed by being blocked with 2% BSA in PBS for 1 h at RT. Then, the cells were incubated with a rabbit anti-ILF2 polyclonal antibody and a mouse anti-nsp9 or anti-nsp2 mAb overnight at 4 °C in a humid chamber. After being rinsed 3 times with PBS, the cells were incubated with fluorescein isothiocyanate (FITC)-conjugated goat anti-rabbit and tetramethyl rhodamine isothiocyanate (TRITC)-conjugated goat anti-mouse secondary antibody for 1 h at RT. Finally, the cells were stained with DAPI, and the images were viewed under an Olympus confocal microscope (Fluoview1000).

ILF2 gene silencing by small interfering RNA (siRNA)

SiRNAs targeting ILF2 gene were designed and synthesized by the GenePharma (Suzhou, China), and were used to analyze the effect of ILF2 knockdown on the replication of PRRSV. MARC-145 cells grown on six-well plates at 30 ~ 40% confluence were transfected with the siRNA using Lipofectamine RNAiMAX reagent (Fisher Scientific) according to the manufacturer’s protocol. After 48 h post-transfection, the cells were harvested for analysis of silencing efficiency or infected with PRRSV JXwn06.

The over-expression of ILF2 in MARC-145 cells

To analyze the influence of the ILF2 over-expression on the replication of PRRSV, MARC-145 cells that were expressing ILF2 were established by lentivirus packaging system according to the manufacturer’s protocol. In brief, MARC-145 cells were transduced with the recombinant lentiviruses that were expressing GFP-ILF2 or GFP with 8 μg/ml of polybrene (Sigma). At 48 h post-transduction, the cells were harvested for analysis of ILF2 expression by western blotting or infected with PRRSV JXwn06 for virus titration.

Viral infection and titration

MARC-145 cells were infected with PRRSV JXwn06 at a MOI of 0.01. Viral titers were titrated by a microtitration infectivity assay as previously described [60].

Statistical analysis

Data are expressed as means ± standard deviations (SD). The statistically significant differences among groups were evaluated by two-way ANOVA using GraphPad Prism (version 5.0) software. Differences were considered statistically significant at a value of p < 0.05.

Results

Cellular ILF2 interacted with the nsp9 of PRRSV

To identify host cellular proteins interacting with the nsp9 of PRRSV, 3D4/21 cells were transduced with the GFP-nsp9-expressing lentiviruses, and 3D4/21 cells transduced with the GFP-expressing lentiviruses served as a control (Fig. 1a). At 48 h post-infection, the cells were harvested and immunoprecipitated with an anti-GFP mAb. The immunoprecipitated proteins were then subjected to SDS-PAGE, and GFP-nsp9 and GFP were examined with an anti-GFP mAb (Fig. 1b) or visualized using silver staining (Fig. 1c). Compared with the control lane, four bands could be detected in the cells that were over-expressing GFP-nsp9. A total of 52 proteins interacting with the nsp9 of PRRSV were successfully identified by LC-MS/MS from the bands in the cells that were expressing nsp9 of PRRSV (Additional file 1). Of these proteins, ILF2 was chosen for further analysis due to its higher score.
Fig. 1

Analysis of cellular proteins interacting with PRRSV nsp9 by IP combined with LC-MS/MS assay. 3D4/21 cells were transduced with GFP-nsp9- or GFP-expressing lentiviruses (a) and then the expression of GFP-nsp9 and GFP in 3D4/21 cells were examined by western blotting (b). The cell lysates were immunoprecipitated with anti-GFP mAb, and were then separated by SDS-PAGE, and followed by silver staining (c). Shown are the differential protein bands between GFP-nsp9- and GFP-expressing 3D4/21 cells. Asterisk indicatess the band from which ILF2 was identified

To confirm the interaction between ILF2 and nsp9, 293FT cells were transfected with ILF2- and nsp9-expressing plasmid. The cell lysates were immunoprecipitated with an anti-HA mAb and were then subjected to western blotting. It was shown that nsp9 could be pulled down in the cells that were co-transfected with ILF2- and nsp9-expressing plasmid (pCMV-HA-ILF2 and pCMV-Myc-nsp9), whereas it could not be done in the cells that were co-transfected with the plasmids pCMV-HA and pCMV-Myc-nsp9 (Fig. 2a). The reciprocal IP assay was also performed and the same results were observed (Fig. 2b).
Fig. 2

Interaction of the nsp9 with ILF2. a and b The interaction of nsp9 with exogenous ILF2. 293FT cells were co-transfected with the indicated plasmids. The cell lysates were immunoprecipitated with an anti-HA mAb and detected with an anti-HA mAb or anti-Myc polyclonal antibody. c The interaction of nsp9 with endogenous ILF2. MARC-145 cells were transduced with GFP-nsp9- or GFP-expressing lentiviruses. The cell lysates were immunoprecipitated with an anti-GFP mAb and detected with an anti-GFP or anti-ILF2 mAb

To further verify the interaction of endogenous ILF2 with the nsp9 of PRRSV in MARC-145 cells, MARC-145 cells were transduced with GFP-nsp9-expressing lentiviruses. The cells transduced with GFP-expressing lentiviruses served as a control. As shown in Fig. 2c, ILF2 could be only detected in the immunoprecipitated samples of cells that were expressing GFP-nsp9, suggesting that endogenous ILF2 in MARC-145 cells could interact with the nsp9 of PRRSV.

Cellular ILF2 interacted with the nsp2 of PRRSV

ILF2 usually forms a heterodimeric complex with ILF3 [42]. Our previous analysis has indicated the interaction of ILF3 with the nsp2 of PRRSV [58]. Therefore, we speculated that ILF2 might also interact with the nsp2 of PRRSV. To confirm this, 293FT cells were transfected with ILF2- and nsp2-expressing plasmids individually or together. It was shown that ILF2 could be precipitated exclusively from the cells co-transfected with the plasmids pCMV-HA-nsp2 and pCMV-Myc-ILF2 (Fig. 3a). The same results were achieved for the interaction of ILF2 and nsp2 by a reciprocal IP assay (Fig. 3b). Giving this finding, we further examined the interaction of endogenous ILF2 with the nsp2 in the context of PRRSV infection. As shown in Fig. 3c, by Co-IP assay with an anti-nsp2 mAb, ILF2 could only be immunoprecipitated in PRRSV JXwn06-infected MARC-145 cells. In addition, ILF3 could also be pulled down by an anti-nsp2 mAb (Fig. 3c). As a whole, the above results indicated that ILF2 could interact with the nsp2 of PRRSV in MARC-145 cells.
Fig. 3

Interaction of the nsp2 with ILF2. a and b The interaction of nsp2 with exogenous ILF2. 293FT cells were co-transfected with the indicated plasmids. The cell lysates were immunoprecipitated with an anti-HA mAb and further probed with an anti-HA mAb or anti-Myc polyclonal antibody. c The interaction of nsp2 with endogenous ILF2 and ILF3. MARC-145 cells were infected with PRRSV JXwn06 and then cell lysates were immunoprecipitated with an anti-nsp2 mAb, and were then detected with an anti-nsp2 or anti-ILF2 mAb or anti-ILF3 polyclonal antibody

The regions responsible for the interaction of ILF2 with the nsp9 or nsp2 of PRRSV

The nsp9 of PRRSV has two domains, a C-terminal RdRp domain and N-terminal domain with unknown function [16]. The nsp2 of PRRSV contains a putative cysteine protease (PL2) domain possessing cleavage activity as well as deubiquitinating activity [6266], a middle hypervariable region with unspecific function and C-terminal transmembrane (TM) domain [67, 68]. To determine the regions of nsp9 and nsp2 responsible for the interaction with ILF2, a serial of truncated mutants, as indicated, expressed as HA- or GFP-fused protein (Fig. 4a and c) were co-transfected with pCMV-Myc-ILF2 in 293FT cells. The cell lysates were precipitated with an anti-HA or anti-GFP mAb. The results showed that the truncated nsp9C retained the ability to interact with ILF2, while the truncated nsp9N did not (Fig. 4b), indicating that the RdRp domain of nsp9 is responsible for its interaction with ILF2. However, all three truncated nsp2 (nsp2N, nsp2M and nsp2C) were able to interact with ILF2 (Fig. 4d).
Fig. 4

The regions responsible for the interaction of ILF2 with nsp9 and nsp2. a The schematic diagram of the truncated nsp9—nsp9N (aa1-385) and nsp9C (aa386-640). b The interaction of ILF2 with nsp9C by Co-IP. 293FT cells were co-transfected with the indicated plasmids. The cell lysates were immunoprecipitated with an anti-HA mAb and further probed with an anti-HA or anti-Myc MAb. c The schematic diagram of three truncated nsp2—nsp2N (aa1-405), nsp2M (aa323-814) and nsp2C (aa323-1166). d The interaction of ILF2 with nsp2N, nsp2M and nsp2C by Co-IP. 293FT cells were co-transfected with the indicated plasmids. The cell lysates were immunoprecipitated with an anti-GFP mAb and further probed with an anti-GFP mAb or anti-Myc polyclonal antibody

ILF2 partly co-localized with the nsp9 or nsp2 of PRRSV in the cytoplasm

Having demonstrated that ILF2 was able to interact with the nsp9 or nsp2 of PRRSV by Co-IP, we further analyzed whether ILF2 co-localizes with nsp9 or nsp2 in PRRSV-infected cells. MARC-145 cells were infected with PRRSV JXwno6 at a MOI of 0.01, and confocal immunofluorescence assay was performed. As shown in Fig. 5a, ILF2 partly could be translocated from the nucleus to the cytoplasm and co-localized in the cytoplasm with the nsp9 or nsp2 in PRRSV-infected MARC-145 cells, while ILF2 extremely localized in the nucleus of mock-infected MARC-145 cells. Similar phenomenon could be observed in PRRSV-infected PAMs (Fig. 5b).
Fig. 5

Co-localization of ILF2 with nsp9 and nsp2 in MARC-145 cells (a) and PAMs (b). The cells were infected with PRRSV JXwn06 at a MOI of 0.01, and were then fixed and double-stained at 36 h post-infection with a rabbit anti-ILF2 polyclonal antibody and a mouse anti-nsp9 or anti-nsp2 mAb, and followed by the FITC-conjugated goat anti-rabbit IgG (green) and TRITC-conjugated goat anti-mouse IgG (red). Nuclei were stained with DAPI

Knockdown of ILF2 favored the replication of PRRSV in MARC-145 cells

The effect of ILF2 knockdown on the replication of PRRSV was analyzed by using siRNAs. MARC-145 cells were transfected with the siRNAs targeting ILF2 and were then harvested for examining the expression of ILF2 or were infected with PRRSV JXwn06 for virus titration. Compared with the normal cells or cells transfected with control siRNAs (SiNC), the cells transfected with ILF2-specific siRNAs (SiILF2) at a final concentration of 20 pmol exhibited a significantly decreased level of ILF2 expression (Fig. 6a and b) (p < 0.001). There was a 5.99-fold, 9.52-fold and 5.27-fold increase of the virus yields in the SiILF2-transfected cells at 24 h (p < 0.01), 36 h (p < 0.001), 48 h (p < 0.05) post-infection, respectively (Fig. 6c), suggesting that the knockdown of ILF2 favors the replication of PRRSV in MARC-145 cells.
Fig. 6

Enhancement of PRRSV replication by ILF2 knockdown in MARC-145 cells. a MARC-145 cells were transfected with different concentrations of siRNAs targeting ILF2 (SiILF2) and the silencing efficiency of ILF2 was examined by western blotting with an anti-ILF2 mAb. The quantity of β-actin was used for normalization of the amount of ILF2 expression. The optical density ratios of ILF2/β-actin are shown with graphs. MARC-145 cells transfected with SiILF2 or negative control siRNA (SiNC), and normal MARC-145 cells, were infected with PRRSV JXwn06 at a MOI of 0.01. The silencing efficiency (b) and the virus titers were examined (c) at the indicated time points post-infection. Data are expressed as means ± SD of three independent experiments (*p < 0.05; ** p < 0.01; *** p < 0.001; ns, no significant)

Over-expression of ILF2 impacted the replication of PRRSV in MARC-145 cells

The effect of ILF2 over-expression on the replication of PRRSV was examined in MARC-145 cells. MARC-145 cells were transduced with the GFP-ILF2- or GFP- expressing lentiviruses, and followed by western blotting for analysis of ILF2 expression or infected with PRRSV JXwn06 for virus titration. The results showed that the expression of GFP-ILF2 could be observed (Fig. 7a) and the expression level of GFP-ILF2 was similar to GFP (Fig. 7b). Over-expression of ILF2 resulted in a significantly decrease of virus titers in PRRSV-infected MARC-145 cells at 24 h (p < 0.01), 36 h (p < 0.01), 48 h (p < 0.05) post-infection (Fig. 7c), suggesting that the over-expression of ILF2 impacts the replication efficiency of PRRSV.
Fig. 7

Inhibition of PRRSV replication by ILF2 over-expression in lentiviruses- transduced MARC-145 cells. Lentiviruses that were expressing GFP-ILF2 or GFP were transduced into MARC-145 cells (a) and then the expression of GFP-nsp9 and GFP in MARC-145 cells were examined by western blotting (b). The β-actin was used for normalization of the expression of ILF2. The transduced MARC-145 cells were infected with PRRSV JXwn06 at a MOI of 0.01. Normal MARC-145 cells were infected with PRRSV JXwn06 as a control. The virus yields were assayed at the indicated time points post-infection (c). Data are expressed as means ± SD of three independent experiments (*p < 0.05; ** p < 0.01; ns, no significant)

Discussion

Viruses can rely on host cellular proteins to complete its infection cycle, and reversely some cellular proteins play important roles in restricting viral replication. The interactions between cellular proteins and viral proteins are involved in the regulation of viral replication. The nsp9, as the RdRp of PRRSV, has been considered to play essential roles in the replication efficiency in vitro and in vivo and the fatal virulence for piglets of the Chinese highly pathogenic PRRSV [33]. Previous studies have demonstrated that several cellular proteins could interact with the nsp9 of PRRSV and their interactions conferred to the regulation of viral replication [3436]. The nsp2 of PRRSV is generally recognized as a multifunctional protein in viral replication and pathogenesis [37, 38]. In the present study, we found porcine cellular ILF2 interacting with the nsp9 of PRRSV by Co-IP combined with LC-MS/MS assay. Then, we employed Co-IP assay to further confirm this interaction in both 293FT cells and MARC-145 cells. Meanwhile, we verified the interaction of ILF2 with the nsp2 of PRRSV. Thus, ILF2 could interact with two nsps of PRRSV—nsp9 and nsp2, which are considered as parts of the viral RTC [16]. The nsp9 is responsible for RNA synthesis as the RdRp, while nsp2, together with nsp3, form the DMVs, which provide the sites for viral RNA synthesis [39, 69]. A similar scenario has been described by Stricker et al. in the case of IBDV [50], showing ILF2 can interact with the viral RdRp VP1, the capsid protein VP2, and the ribonucleoprotein VP3 in different cell lines. Thus, we proposed that the cellular protein ILF2 possibly participates in the RTC of PRRSV either by the viral exploitation or as a host defense mechanism. Certainly, further investigation is required to support this hypothesis.

The cellular proteins usually localize in appropriate subcellular compartments to execute their biological functions. Once the cells are infected with viruses, some cellular proteins can re-locate in favor of viral replication or against viral replication. In IBDV-infected cells, ILF2 gradually has been shown to be translocated from the nucleus to the cytoplasm, and cytoplasmic ILF2 accumulates at the sites of viral replication where VP1, VP2, and VP3 localize [50]. Similar findings are described in HCV, indicating that ILF2 not only co-localizes with viral NS5A, but also interacts with the viral genome RNA [70]. Similarly, our findings revealed that the cellular ILF2 could be translocated partly from the nucleus to the cytoplasm and co-localized with the nsp9 and nsp2 of PRRSV in PRRSV-infected MARC-145 cells and PAMs, while ILF2 only localized in the nucleus in non-infected cells. Thus, we proposed that during PRRSV infection the translocation of ILF2 from the nucleus to the cytoplasm is likely involved in the formation of viral replication complexes (RTC), and successively exerts the biological effect of regulating the replication of PRRSV. In spite of the fact that ILF2 interacts with the genomic RNA of HCV [70], whether ILF2 interacts with genomic RNA and/or subgenomic RNA of PRRSV is required to be further explored.

To address the biological significance of interaction between ILF2 with the nsp9 and nsp2 on the replication of PRRSV, we analyzed the effect of ILF2 knockdown by siRNA silencing and ILF2 over-expression by the lentivirus packaging system on the replication of PRRSV in MARC-145 cells. Our results indicated that ILF2 knockdown favored the viral replication, while ILF2 over-expression impaired the viral replication, suggesting that ILF2 play negatively regulatory effect on the replication of PRRSV. Previous studies have shown that ILF2 silencing promotes the replication of IBDV [50], and knockdown of ILF3—the ILF2 partner also enhances the replication of vesicular stomatitis virus [57] and influenza virus [52]. It is proposed that ILF2 might act as a restriction factor for PRRSV replication by exerting regulatory effect on the genome transcription or protein expression of PRRSV, but the exact mechanism concerning the role of ILF2 in the replication process of PRRSV needs to be done in the future.

Conclusion

As a whole, our findings are the first to confirm that the porcine ILF2 interacts with the nsp9 and nsp2 of PRRSV in vitro, and exerts negatively regulatory effect on the replication of PRRSV. Our present study provides more evidence for understanding the roles of the interactions between cellular proteins and viral proteins in the replication of PRRSV.

Abbreviations

ILF2: 

Interleukin-2 enhancer binding factor 2

nsp2: 

nonstructural protein 2

nsp9: 

nonstructural protein 9

PAMs: 

Pulmonary alveolar macrophages

PRRSV: 

Porcine reproductive and respiratory syndrome virus

Declarations

Acknowledgements

Not applicable.

Funding

This study was supported by Key project of National Natural Science Funds from National Natural Science Foundation of China (31330077) and National Key Basic Research Plan Grant (2014CB542700) from the Chinese Ministry of Science and Technology, and the earmarked fund for Modern Agro-industry Technology Research System of China (CARS-36) from the Chinese Ministry of Agriculture.

Availability of data and materials

The datasets are available upon request.

Authors’ contributions

HY, KY, and XW designed the study. XW, TB, ZZ, LZ, and Xinna Ge performed the experiments in the study. JH and Xin Guo analyzed the data. XW and HY wrote and edited the manuscript. All authors read and approved the final manuscript.

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Authors’ Affiliations

(1)
Key Laboratory of Animal Epidemiology of the Ministry of Agriculture, College of Veterinary Medicine and State Key Laboratory of Agrobiotechnology, China Agricultural University
(2)
The Chinese Ministry of Agriculture

References

  1. Neumann EJ, Kliebenstein JB, Johnson CD, Mabry JW, Bush EJ, Seitzinger AH, et al. Assessment of the economic impact of porcine reproductive and respiratory syndrome on swine production in the United States. J Am Vet Med Assoc. 2005;227:385–92.View ArticlePubMedGoogle Scholar
  2. Pejsak Z, Stadejek T, Markowska-Daniel I. Clinical signs and economic losses caused by porcine reproductive and respiratory syndrome virus in a large breeding farm. Vet Microbiol. 1997;55:317–22.View ArticlePubMedGoogle Scholar
  3. Zhou L, Yang H. Porcine reproductive and respiratory syndrome in China. Virus Res. 2010;154:31–7.View ArticlePubMedGoogle Scholar
  4. Cavanagh D. Nidovirales: a new order comprising Coronaviridae and Arteriviridae. Arch Virol. 1997;142:629–33.PubMedGoogle Scholar
  5. Kuhn JH, Lauck M, Bailey AL, Shchetinin AM, Vishnevskaya TV, Bao Y, et al. Reorganization and expansion of the nidoviral family Arteriviridae. Arch Virol. 2016;161:755–68.View ArticlePubMedGoogle Scholar
  6. Conzelmann KK, Visser N, Van Woensel P, Thiel HJ. Molecular characterization of porcine reproductive and respiratory syndrome virus, a member of the arterivirus group. Virology. 1993;193:329–39.View ArticlePubMedGoogle Scholar
  7. Fang Y, Treffers EE, Li Y, Tas A, Sun Z, van der Meer Y, et al. Efficient −2 frameshifting by mammalian ribosomes to synthesize an additional arterivirus protein. Proc Natl Acad Sci U S A. 2012;109:E2920–8.View ArticlePubMedPubMed CentralGoogle Scholar
  8. Firth AE, Zevenhoven-Dobbe JC, Wills NM, Go YY, Balasuriya UB, Atkins JF, et al. Discovery of a small arterivirus gene that overlaps the GP5 coding sequence and is important for virus production. J Gen Virol. 2011;92:1097–106.View ArticlePubMedPubMed CentralGoogle Scholar
  9. Johnson CR, Griggs TF, Gnanandarajah J, Murtaugh MP. Novel structural protein in porcine reproductive and respiratory syndrome virus encoded by an alternative ORF5 present in all arteriviruses. J Gen Virol. 2011;92:1107–16.View ArticlePubMedPubMed CentralGoogle Scholar
  10. Meulenberg JJ, Petersen den Besten A, de Kluyver E, van Nieuwstadt A, Wensvoort G, Moormann RJ. Molecular characterization of Lelystad virus. Vet Microbiol. 1997;55:197–202.View ArticlePubMedGoogle Scholar
  11. Snijder EJ, Meulenberg JJ. The molecular biology of arteriviruses. J Gen Virol. 1998;79(Pt 5):961–79.View ArticlePubMedGoogle Scholar
  12. Wu WH, Fang Y, Farwell R, Steffen-Bien M, Rowland RR, Christopher-Hennings J, Nelson EA. A 10-kDa structural protein of porcine reproductive and respiratory syndrome virus encoded by ORF2b. Virology. 2001;287:183–91.View ArticlePubMedGoogle Scholar
  13. Kappes MA, Faaberg KS. PRRSV structure, replication and recombination: Origin of phenotype and genotype diversity. Virology. 2015;479-480:475–86.View ArticlePubMedGoogle Scholar
  14. den Boon JA, Faaberg KS, Meulenberg JJ, Wassenaar AL, Plagemann PG, Gorbalenya AE, Snijder EJ. Processing and evolution of the N-terminal region of the arterivirus replicase ORF1a protein: identification of two papainlike cysteine proteases. J Virol. 1995;69:4500–5.Google Scholar
  15. Faaberg KS, Balasuriya UB, Brinton MA, Gorbalenya AE, Leung FC, Nauwynck H, et al. Familyarteriviridae. In: King AMQ, editor. Virus Taxonomy: Classification and Nomenclature of Viruses: Ninth Report of the International Committee on Taxonomy of Viruses. Amsterdam: Elsevier/Academic Press; 2012. p. 796–805.Google Scholar
  16. Fang Y, Snijder EJ. The PRRSV replicase: exploring the multifunctionality of an intriguing set of nonstructural proteins. Virus Res. 2010;154:61–76.View ArticlePubMedGoogle Scholar
  17. van Dinten LC, Wassenaar AL, Gorbalenya AE, Spaan WJ, Snijder EJ. Processing of the equine arteritis virus replicase ORF1b protein: identification of cleavage products containing the putative viral polymerase and helicase domains. J Virol. 1996;70:6625–33.PubMedPubMed CentralGoogle Scholar
  18. Bautista EM, Meulenberg JJ, Choi CS, Molitor TW. Structural polypeptides of the American (VR-2332) strain of porcine reproductive and respiratory syndrome virus. Arch Virol. 1996;141:1357–65.View ArticlePubMedGoogle Scholar
  19. Mardassi H, Mounir S, Dea S. Molecular analysis of the ORFs 3 to 7 of porcine reproductive and respiratory syndrome virus, Quebec reference strain. Arch Virol. 1995;140:1405–18.View ArticlePubMedGoogle Scholar
  20. Meng XJ, Paul PS, Halbur PG. Molecular cloning and nucleotide sequencing of the 3′-terminal genomic RNA of the porcine reproductive and respiratory syndrome virus. J Gen Virol. 1994;75(Pt 7):1795–801.View ArticlePubMedGoogle Scholar
  21. Meulenberg JJ, Petersen-den Besten A, De Kluyver EP, Moormann RJ, Schaaper WM, Wensvoort G. Characterization of proteins encoded by ORFs 2 to 7 of Lelystad virus. Virology. 1995;206:155–63.View ArticlePubMedGoogle Scholar
  22. van Nieuwstadt AP, Meulenberg JJ, van Essen-Zanbergen A, Petersen-den Besten A, Bende RJ, Moormann RJ, Wensvoort G. Proteins encoded by open reading frames 3 and 4 of the genome of Lelystad virus (Arteriviridae) are structural proteins of the virion. J Virol. 1996;70:4767–72.PubMedPubMed CentralGoogle Scholar
  23. Kappes MA, Miller CL, Faaberg KS. Highly divergent strains of porcine reproductive and respiratory syndrome virus incorporate multiple isoforms of nonstructural protein 2 into virions. J Virol. 2013;87:13456–65.View ArticlePubMedPubMed CentralGoogle Scholar
  24. Kappes MA, Miller CL, Faaberg KS. Porcine reproductive and respiratory syndrome virus nonstructural protein 2 (nsp2) topology and selective isoform integration in artificial membranes. Virology. 2015;481:51–62.View ArticlePubMedGoogle Scholar
  25. Meng XJ, Paul PS, Halbur PG, Lum MA. Phylogenetic analyses of the putative M (ORF 6) and N (ORF 7) genes of porcine reproductive and respiratory syndrome virus (PRRSV): implication for the existence of two genotypes of PRRSV in the U.S.A. and Europe. Arch Virol. 1995;140:745–55.View ArticlePubMedGoogle Scholar
  26. Nelson EA, Christopher-Hennings J, Drew T, Wensvoort G, Collins JE, Benfield DA. Differentiation of U.S. and European isolates of porcine reproductive and respiratory syndrome virus by monoclonal antibodies. J Clin Microbiol. 1993;31:3184–9.PubMedPubMed CentralGoogle Scholar
  27. Shi M, Lam TT, Hon CC, Hui RK, Faaberg KS, Wennblom T, et al. Molecular epidemiology of PRRSV: a phylogenetic perspective. Virus Res. 2010;154:7–17.View ArticlePubMedGoogle Scholar
  28. Beura LK, Sarkar SN, Kwon B, Subramaniam S, Jones C, Pattnaik AK, Osorio FA. Porcine reproductive and respiratory syndrome virus nonstructural protein 1beta modulates host innate immune response by antagonizing IRF3 activation. J Virol. 2010;84:1574–84.View ArticlePubMedGoogle Scholar
  29. He Q, Li Y, Zhou L, Ge X, Guo X, Yang H. Both Nsp1beta and Nsp11 are responsible for differential TNF-alpha production induced by porcine reproductive and respiratory syndrome virus strains with different pathogenicity in vitro. Virus Res. 2015;201:32–40.View ArticlePubMedGoogle Scholar
  30. Li H, Zheng Z, Zhou P, Zhang B, Shi Z, Hu Q, Wang H. The cysteine protease domain of porcine reproductive and respiratory syndrome virus non-structural protein 2 antagonizes interferon regulatory factor 3 activation. J Gen Virol. 2010;91:2947–58.View ArticlePubMedGoogle Scholar
  31. Shi X, Wang L, Li X, Zhang G, Guo J, Zhao D, et al. Endoribonuclease activities of porcine reproductive and respiratory syndrome virus nsp11 was essential for nsp11 to inhibit IFN-beta induction. Mol Immunol. 2011;48:1568–72.View ArticlePubMedGoogle Scholar
  32. Yoo D, Song C, Sun Y, Du Y, Kim O, Liu HC. Modulation of host cell responses and evasion strategies for porcine reproductive and respiratory syndrome virus. Virus Res. 2010;154:48–60.View ArticlePubMedGoogle Scholar
  33. Li Y, Zhou L, Zhang J, Ge X, Zhou R, Zheng H, et al. Nsp9 and Nsp10 contribute to the fatal virulence of highly pathogenic porcine reproductive and respiratory syndrome virus emerging in China. PLoS Pathog. 2014;10:e1004216.View ArticlePubMedPubMed CentralGoogle Scholar
  34. Dong J, Zhang N, Ge X, Zhou L, Guo X, Yang H. The interaction of nonstructural protein 9 with retinoblastoma protein benefits the replication of genotype 2 porcine reproductive and respiratory syndrome virus in vitro. Virology. 2014;464-465:432–40.View ArticlePubMedGoogle Scholar
  35. Li J, Guo D, Huang L, Yin M, Liu Q, Wang Y, et al. The interaction between host Annexin A2 and viral Nsp9 is beneficial for replication of porcine reproductive and respiratory syndrome virus. Virus Res. 2014;189:106–13.View ArticlePubMedGoogle Scholar
  36. Zhao S, Ge X, Wang X, Liu A, Guo X, Zhou L, et al. The DEAD-box RNA helicase 5 positively regulates the replication of porcine reproductive and respiratory syndrome virus by interacting with viral Nsp9 in vitro. Virus Res. 2015;195:217–24.View ArticlePubMedGoogle Scholar
  37. Faaberg KS, Kehrli ME Jr, Lager KM, Guo B, Han J. In vivo growth of porcine reproductive and respiratory syndrome virus engineered nsp2 deletion mutants. Virus Res. 2010;154:77–85.View ArticlePubMedGoogle Scholar
  38. Han J, Rutherford MS, Faaberg KS. Proteolytic products of the porcine reproductive and respiratory syndrome virus nsp2 replicase protein. J Virol. 2010;84:10102–12.View ArticlePubMedPubMed CentralGoogle Scholar
  39. Snijder EJ, van Tol H, Roos N, Pedersen KW. Non-structural proteins 2 and 3 interact to modify host cell membranes during the formation of the arterivirus replication complex. J Gen Virol. 2001;82:985–94.View ArticlePubMedGoogle Scholar
  40. Song T, Fang L, Wang D, Zhang R, Zeng S, An K, et al. Quantitative interactome reveals that porcine reproductive and respiratory syndrome virus nonstructural protein 2 forms a complex with viral nucleocapsid protein and cellular vimentin. J Proteome. 2016;142:70–81.View ArticleGoogle Scholar
  41. Pedersen KW, van der Meer Y, Roos N, Snijder EJ. Open reading frame 1a-encoded subunits of the arterivirus replicase induce endoplasmic reticulum-derived double-membrane vesicles which carry the viral replication complex. J Virol. 1999;73:2016–26.PubMedPubMed CentralGoogle Scholar
  42. Kao PN, Chen L, Brock G, Ng J, Kenny J, Smith AJ, Corthesy B. Cloning and expression of cyclosporin A- and FK506-sensitive nuclear factor of activated T-cells: NF45 and NF90. J Biol Chem. 1994;269:20691–9.PubMedGoogle Scholar
  43. Shamanna RA, Hoque M, Lewis-Antes A, Azzam EI, Lagunoff D, Pe'ery T, Mathews MB. The NF90/NF45 complex participates in DNA break repair via nonhomologous end joining. Mol Cell Biol. 2011;31:4832–43.View ArticlePubMedPubMed CentralGoogle Scholar
  44. Kiesler P, Haynes PA, Shi L, Kao PN, Wysocki VH, Vercelli D. NF45 and NF90 regulate HS4-dependent interleukin-13 transcription in T cells. J Biol Chem. 2010;285:8256–67.View ArticlePubMedPubMed CentralGoogle Scholar
  45. Sakamoto S, Aoki K, Higuchi T, Todaka H, Morisawa K, Tamaki N, et al. The NF90-NF45 complex functions as a negative regulator in the microRNA processing pathway. Mol Cell Biol. 2009;29:3754–69.View ArticlePubMedPubMed CentralGoogle Scholar
  46. Todaka H, Higuchi T, Yagyu K, Sugiyama Y, Yamaguchi F, Morisawa K, et al. Overexpression of NF90-NF45 Represses Myogenic MicroRNA Biogenesis, Resulting in Development of Skeletal Muscle Atrophy and Centronuclear Muscle Fibers. Mol Cell Biol. 2015;35:2295–308.View ArticlePubMedPubMed CentralGoogle Scholar
  47. Kuwano Y, Kim HH, Abdelmohsen K, Pullmann R Jr, Martindale JL, Yang X, Gorospe M. MKP-1 mRNA stabilization and translational control by RNA-binding proteins HuR and NF90. Mol Cell Biol. 2008;28:4562–75.View ArticlePubMedPubMed CentralGoogle Scholar
  48. Kuwano Y, Pullmann R Jr, Marasa BS, Abdelmohsen K, Lee EK, Yang X, et al. NF90 selectively represses the translation of target mRNAs bearing an AU-rich signature motif. Nucleic Acids Res. 2010;38:225–38.View ArticlePubMedGoogle Scholar
  49. Lee JW, Liao PC, Young KC, Chang CL, Chen SS, Chang TT, et al. Identification of hnRNPH1, NF45, and C14orf166 as novel host interacting partners of the mature hepatitis C virus core protein. J Proteome Res. 2011;10:4522–34.View ArticlePubMedGoogle Scholar
  50. Stricker RL, Behrens SE, Mundt E. Nuclear factor NF45 interacts with viral proteins of infectious bursal disease virus and inhibits viral replication. J Virol. 2010;84:10592–605.View ArticlePubMedPubMed CentralGoogle Scholar
  51. Merrill MK, Gromeier M. The double-stranded RNA binding protein 76:NF45 heterodimer inhibits translation initiation at the rhinovirus type 2 internal ribosome entry site. J Virol. 2006;80:6936–42.View ArticlePubMedPubMed CentralGoogle Scholar
  52. Wang P, Song W, Mok BW, Zhao P, Qin K, Lai A, et al. Nuclear factor 90 negatively regulates influenza virus replication by interacting with viral nucleoprotein. J Virol. 2009;83:7850–61.View ArticlePubMedPubMed CentralGoogle Scholar
  53. Li T, Li X, Zhu W, Wang H, Mei L, Wu S, et al. NF90 is a novel influenza A virus NS1-interacting protein that antagonizes the inhibitory role of NS1 on PKR phosphorylation. FEBS Lett. 2016;590:2797–810.View ArticlePubMedGoogle Scholar
  54. Gomila RC, Martin GW, Gehrke L. NF90 binds the dengue virus RNA 3′ terminus and is a positive regulator of dengue virus replication. PLoS One. 2011;6:e16687.View ArticlePubMedPubMed CentralGoogle Scholar
  55. Li Y, Belshan M. NF45 and NF90 Bind HIV-1 RNA and Modulate HIV Gene Expression. Viruses. 2016;8:47.View ArticlePubMed CentralGoogle Scholar
  56. Murphy J, Hall WW, Ratner L, Sheehy N. Novel interactions between the HTLV antisense proteins HBZ and APH-2 and the NFAR protein family: Implications for the HTLV lifecycles. Virology. 2016;494:129–42.View ArticlePubMedPubMed CentralGoogle Scholar
  57. Pfeifer I, Elsby R, Fernandez M, Faria PA, Nussenzveig DR, Lossos IS, et al. NFAR-1 and -2 modulate translation and are required for efficient host defense. Proc Natl Acad Sci U S A. 2008;105:4173–8.View ArticlePubMedPubMed CentralGoogle Scholar
  58. Wang L, Zhou L, Zhang H, Li Y, Ge X, Guo X, et al. Interactome profile of the host cellular proteins and the nonstructural protein 2 of porcine reproductive and respiratory syndrome virus. PLoS One. 2014;9:e99176.View ArticlePubMedPubMed CentralGoogle Scholar
  59. Zhang H, Guo X, Ge X, Chen Y, Sun Q, Yang H. Changes in the cellular proteins of pulmonary alveolar macrophage infected with porcine reproductive and respiratory syndrome virus by proteomics analysis. J Proteome Res. 2009;8:3091–7.View ArticlePubMedGoogle Scholar
  60. Zhou L, Zhang J, Zeng J, Yin S, Li Y, Zheng L, et al. The 30-amino-acid deletion in the Nsp2 of highly pathogenic porcine reproductive and respiratory syndrome virus emerging in China is not related to its virulence. J Virol. 2009;83:5156–67.View ArticlePubMedPubMed CentralGoogle Scholar
  61. Wang X, Li C, Zhou L, Zhang N, Wang X, Ge X, et al. Porcine reproductive and respiratory syndrome virus counteracts the porcine intrinsic virus restriction factors-IFITM1 and Tetherin in MARC-145 cells. Virus Res. 2014;191:92–100.View ArticlePubMedGoogle Scholar
  62. Han J, Rutherford MS, Faaberg KS. The porcine reproductive and respiratory syndrome virus nsp2 cysteine protease domain possesses both trans- and cis-cleavage activities. J Virol. 2009;83:9449–63.View ArticlePubMedPubMed CentralGoogle Scholar
  63. Sun Z, Chen Z, Lawson SR, Fang Y. The cysteine protease domain of porcine reproductive and respiratory syndrome virus nonstructural protein 2 possesses deubiquitinating and interferon antagonism functions. J Virol. 2010;84:7832–46.View ArticlePubMedPubMed CentralGoogle Scholar
  64. Sun Z, Li Y, Ransburgh R, Snijder EJ, Fang Y. Nonstructural protein 2 of porcine reproductive and respiratory syndrome virus inhibits the antiviral function of interferon-stimulated gene 15. J Virol. 2012;86:3839–50.View ArticlePubMedPubMed CentralGoogle Scholar
  65. van Kasteren PB, Beugeling C, Ninaber DK, Frias-Staheli N, van Boheemen S, Garcia-Sastre A, et al. Arterivirus and nairovirus ovarian tumor domain-containing Deubiquitinases target activated RIG-I to control innate immune signaling. J Virol. 2012;86:773–85.View ArticlePubMedPubMed CentralGoogle Scholar
  66. van Kasteren PB, Bailey-Elkin BA, James TW, Ninaber DK, Beugeling C, Khajehpour M, et al. Deubiquitinase function of arterivirus papain-like protease 2 suppresses the innate immune response in infected host cells. Proc Natl Acad Sci U S A. 2013;110:E838–47.View ArticlePubMedPubMed CentralGoogle Scholar
  67. Han J, Liu G, Wang Y, Faaberg KS. Identification of nonessential regions of the nsp2 replicase protein of porcine reproductive and respiratory syndrome virus strain VR-2332 for replication in cell culture. J Virol. 2007;81:9878–90.View ArticlePubMedPubMed CentralGoogle Scholar
  68. Han J, Wang Y, Faaberg KS. Complete genome analysis of RFLP 184 isolates of porcine reproductive and respiratory syndrome virus. Virus Res. 2006;122:175–82.View ArticlePubMedGoogle Scholar
  69. Shulla A, Randall G. (+) RNA virus replication compartments: a safe home for (most) viral replication. Curr Opin Microbiol. 2016;32:82–8.View ArticlePubMedGoogle Scholar
  70. Isken O, Baroth M, Grassmann CW, Weinlich S, Ostareck DH, Ostareck-Lederer A, Behrens SE. Nuclear factors are involved in hepatitis C virus RNA replication. RNA. 2007;13:1675–92.View ArticlePubMedPubMed CentralGoogle Scholar

Copyright

© The Author(s). 2017

Advertisement